AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i218_Ribosomal_Operon_5_bsub_reg_300.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 rpmB 276 ribosomal protein L28 Motif number 1 TTCCTCCTTCGAATGCATAGAGTTACAGCT 1 16 1 GAATGCATAG 0.982221 -261 TTTCATAATGGAAACCATATAGTAGAATAG 1 44 0 GAAACCATAT 0.993554 -233 GAAAGATGATGAAACAATAGTTGCAAACGT 1 155 1 GAAACAATAG 0.969657 -122 ATTATTTAAAGTATCCATATCGAAAGCATC 1 201 1 GTATCCATAT 0.967018 -76 TATCCATATCGAAAGCATCTAAGATTATAT 1 212 1 GAAAGCATCT 0.979424 -65 ********** Masking position 7 Map Score: 5.55883 Number of sites scoring better than the average of aligned sites = 151 Number in coding regions = 130 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 2 CATAGAGTTACAGCTATTCTACTATATGGT 1 31 1 CAGCTATTCT 0.988292 -246 GAGGTACGGCCAGCGATTATTGCCTGGTCT 1 74 0 CAGCGATTAT 0.95228 -203 CGTACCTCTACATATACTATAGCGCTGCTG 1 96 1 CATATACTAT 0.948562 -181 AAAACGTTTGCAACTATTGTTTCATCATCT 1 158 0 CAACTATTGT 0.943851 -119 TTTTAACATTCATATAATCTTAGATGCTTT 1 223 0 CATATAATCT 0.912725 -54 TTGCACAAAACATCTACTTTTTAACATTCA 1 241 0 CATCTACTTT 0.968698 -36 ********** Masking position 6 Map Score: 3.21766 Number of sites scoring better than the average of aligned sites = 291 Number in coding regions = 243 Number in noncoding regions = 48 Number of orfs with sites within 600 bp upstream = 53 Fraction of orfs with sites within 600 bp upstream = 0.00851269 Motif number 3 ATGGTTTCCATTATGAAAAGACCAGGCAAT 1 56 1 TTATGAAAAG 0.93188 -221 GCGCTATAGTATATGTAGAGGTACGGCCAG 1 91 0 ATATGTAGAG 0.968452 -186 TGTTTCCGCAAGATGTCAAGTGAATTTTCT 1 124 1 AGATGTCAAG 0.962212 -153 TTGTTTCATCATCTTTCAAGAAAATTCACT 1 142 0 ATCTTTCAAG 0.918705 -135 CTGTGGTAAATTATTTAAAGTATCCATATC 1 192 1 TTATTTAAAG 0.952329 -85 TAAAGTATCCATATCGAAAGCATCTAAGAT 1 207 1 ATATCGAAAG 0.933747 -70 ********** Masking position 4 Map Score: 1.60003 Number of sites scoring better than the average of aligned sites = 520 Number in coding regions = 402 Number in noncoding regions = 118 Number of orfs with sites within 600 bp upstream = 148 Fraction of orfs with sites within 600 bp upstream = 0.0237713 Motif number 4 TAGTAGAATAGCTGTAACTCTATGCATTCGAA 1 23 0 GCGTACTCTA 0.997786 -254 ATAATCGCTGGCCGTACCTCTACATATACTAT 1 84 1 GCGTACTCTA 0.997786 -193 TCTTGCGGAAACAGCAGCGCTATAGTATATGT 1 105 0 ACGCACGCTA 0.991506 -172 ** *** ***** Masking position 6 Map Score: 0.128291 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 9 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 TGCATTCGAAGGAGGAACTAGT 1 3 0 GGAGGAACTA 0.968686 -274 CTTGACATCTTGCGGAAACAGCAGCGCTAT 1 114 0 TGCGGAAACA 0.991197 -163 TCTTGAAAGATGATGAAACAATAGTTGCAA 1 151 1 TGATGAAACA 0.970161 -126 TGCAAGTGAGGAGGGAAACAA 1 266 1 GAGGGAAACA 0.977935 -11 ********** Masking position 6 Map Score: 0.021532 Number of sites scoring better than the average of aligned sites = 574 Number in coding regions = 468 Number in noncoding regions = 106 Number of orfs with sites within 600 bp upstream = 101 Fraction of orfs with sites within 600 bp upstream = 0.0162223 Motif number 6 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.09013e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0