AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i232_formulase_bsub_reg_300.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yloB 115 similar to calcium-transporting ATPase #2 yloC 82 similar to hypothetical proteins #3 yloD 233 similar to guanylate kinase #4 yloI 80 similar to pantothenate metabolism flavoprotein #5 def 26 polypeptide deformylase Motif number 1 ATCGAATGCAGGAAGAATGAGAGGGTGTA 1 3 0 GGGATAGAGG 0.980929 -113 GCATGAAATGGGACGAGTCAGAATAAGCATGCTTATA 1 47 1 GGGATAGATG 0.95262 -69 CTCTATAAGAGAGCAGGGGAGTGGACGAGCGGA 1 93 1 GAAGGAGTGG 0.981761 -23 TTTATTATGAGAACAGGGAAGAATTGGGTGTTTTAAA 2 56 1 GAAGGAGATG 0.991555 -27 TATTTTACAGGGGGAACGTAGAAGATGACGATTAAAC 3 63 1 GGAAGAGAGG 0.992996 -171 GAAATCATCCGATTGGCGGAGATGATATTGCCAAATC 3 112 0 GAGGGAGAGA 0.98155 -122 TCATCCGTTTGATTGGCGCAGACTCCGGGCTGACAAT 3 150 0 GAGGGAGATG 0.994659 -84 GTGCGGTTTTGTAAAGTGCAGAGGGGGAGAATTCA 4 56 1 GTAGGAGAGG 0.989165 -25 ** ** * *** * * Masking position 10 Map Score: 8.8902 Number of sites scoring better than the average of aligned sites = 474 Number in coding regions = 413 Number in noncoding regions = 61 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 2 TTATTCTGACTCGTCCCATTTCATGCTATA 1 43 0 TCGTCCCATT 0.980227 -73 AACACCCAATTCTTCCCTGTTCTCATAATA 2 58 0 TCTTCCCTGT 0.938561 -25 AATCCGATATTAATCAGTTTAATCGTCATC 3 86 0 TAATCAGTTT 0.796888 -148 ACAATCGAAATCATCCGATTGGCGGAGATG 3 125 0 TCATCCGATT 0.988747 -109 GCATCCTGAATCATCCGTTTGATTGGCGCA 3 167 0 TCATCCGTTT 0.993937 -67 GGGTTCTTCGTCCGTATGTAGCGTCAA 3 217 0 TCGTCCGTAT 0.981748 -17 ********** Masking position 4 Map Score: 5.02744 Number of sites scoring better than the average of aligned sites = 449 Number in coding regions = 410 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 3 CATGCTATAATTATCGAATGCAGGAAGAAT 1 22 0 TTATCGAATG 0.933318 -94 CATTCGATAATTATAGCATGAAATGGGACG 1 32 1 TTATAGCATG 0.991254 -84 ATAAGCATGCTTATAGAGTGATATCTCTAT 1 69 1 TTATAGAGTG 0.969455 -47 ACCCCTAAGATTATATCATATGAAT 2 6 0 TTATATCATA 0.855589 -77 ATCTTAGGGGTAATAGCGTGTCTATTGCCC 2 25 1 TAATAGCGTG 0.958635 -58 AAGTAGCAACCTATATCATGTAGGTTGTTA 4 17 1 CTATATCATG 0.93334 -64 ********** Masking position 4 Map Score: 4.12183 Number of sites scoring better than the average of aligned sites = 205 Number in coding regions = 153 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 62 Fraction of orfs with sites within 600 bp upstream = 0.00995824 Motif number 4 CCTAGTAAGACCGTCTGTAAACAATACGCA 3 17 0 CCGTCTGTAA 0.986006 -217 CTTCTACGTTCCCCCTGTAAAATAGACGTC 3 57 0 CCCCCTGTAA 0.97827 -177 TTTCGATTGTCAGCCCGGAGTCTGCGCCAA 3 145 1 CAGCCCGGAG 0.974469 -89 GGTTCTTCGTCCGTATGTAGCGTCAATTAG 3 213 0 CCGTATGTAG 0.9712 -21 CTTTACAAAACCGCACGGAAAAAAATAACA 4 42 0 CCGCACGGAA 0.987942 -39 ********** Masking position 9 Map Score: 2.2006 Number of sites scoring better than the average of aligned sites = 415 Number in coding regions = 385 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 5 GGGTAATAGCGTGTCTATTGCCCTTTTATT 2 32 1 GTGTCTATTG 0.947607 -51 TGACTGTGCGTATTGTTTACAGACG 3 6 1 GTGCGTATTG 0.903323 -228 AATATCATCTCCGCCAATCGGATGATTTCG 3 120 1 CCGCCAATCG 0.989925 -114 AGACTCCGGGCTGACAATCGAAATCATCCG 3 138 0 CTGACAATCG 0.94022 -96 CCCGGAGTCTGCGCCAATCAAACGGATGAT 3 158 1 GCGCCAATCA 0.984502 -76 TCCGTATGTAGCGTCAATTAGCATTCCGCG 3 204 0 GCGTCAATTA 0.947173 -30 ********** Masking position 7 Map Score: 2.1609 Number of sites scoring better than the average of aligned sites = 722 Number in coding regions = 686 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 6 ATCTCTATAAGAGAGCAGGGGAGTGGACGA 1 91 1 GAGAGCAGGG 0.997187 -25 CTTTTATTATGAGAACAGGGAAGAATTGGG 2 54 1 GAGAACAGGG 0.99584 -29 CAGGATGCAAGAGACCGCGGAATGCTAATT 3 189 1 GAGACCGCGG 0.993864 -45 ********** Masking position 4 Map Score: 1.42841 Number of sites scoring better than the average of aligned sites = 26 Number in coding regions = 20 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 7 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0