AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i248_cell_division_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 smc 100 chromosome segregation SMC protein homolg #2 ftsE 233 cell-division ATP-binding protein Motif number 1 AATCCCCCTTATGACTCAGG 1 1 1 AATCCCCCTT 0.996706 -100 TACATACTGAAATCCCCCTGAGTCATAAGG 1 17 0 AATCCCCCTG 0.992733 -84 AGCGATCCTCCTTATGTAATAAG 1 88 0 GATCCTCCTT 0.992157 -13 GATAAAAACATCCTTGCCGAGTGCT 2 6 1 AAACATCCTT 0.988073 -228 CAAGGCATAAAAACATCCTTGCCAGCACTC 2 29 0 AAACATCCTT 0.988073 -205 ********** Masking position 2 Map Score: 9.15049 Number of sites scoring better than the average of aligned sites = 115 Number in coding regions = 52 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 80 Fraction of orfs with sites within 600 bp upstream = 0.0128493 Motif number 2 AATCCCCCTTATGACTCAGGGGGATTTCA 1 8 1 CTTATGACAG 0.962878 -93 TATGCCGTCTTATTTGACCAATGTTTATGATA 1 45 1 TATTTGACAT 0.955161 -56 TTGACCAATGTTTATGATAGAATTGAAATACT 1 58 1 TTTATGATAA 0.798168 -43 AATTGAAATACTTATTACATAAGGAGGATCGC 1 78 1 CTTATTACAA 0.923316 -23 ATTACAGTTTCTTTTCATTCATATTGTCAAGG 2 54 0 CTTTTCATAT 0.886451 -180 ATTATGTCTAAATTTGACGTATAATGAAGTGT 2 89 1 AATTTGACAT 0.893964 -145 GATTTTTCATCTTTTTACAAATGAATGGGTCA 2 141 1 CTTTTTACAT 0.974046 -93 CATTCGACAATTTATGACCCATTCATTTGTAA 2 155 0 TTTATGACAT 0.970555 -79 TCTTTTATATCATTTTATCTATCACACGGTCA 2 200 0 CATTTTATAT 0.874711 -34 ******** ** Masking position 7 Map Score: 5.32742 Number of sites scoring better than the average of aligned sites = 1146 Number in coding regions = 974 Number in noncoding regions = 172 Number of orfs with sites within 600 bp upstream = 207 Fraction of orfs with sites within 600 bp upstream = 0.0332477 Motif number 3 CCCCCTGAGTCATAAGGGGGATT 1 4 0 CATAAGGGGG 0.984144 -97 ATACTTATTACATAAGGAGGATCGCT 1 85 1 CATAAGGAGG 0.99063 -16 GCCAGCACTCGGCAAGGATGTTTTTATC 2 9 0 GGCAAGGATG 0.993983 -225 GCCGAGTGCTGGCAAGGATGTTTTTATGCC 2 26 1 GGCAAGGATG 0.993983 -208 ********** Masking position 5 Map Score: 3.66461 Number of sites scoring better than the average of aligned sites = 68 Number in coding regions = 47 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 4 GACTCAGGGGGATTTCAGTATGTATGCCGTC 1 23 1 GATTTCATAT 0.934231 -78 ATGTAATAAGTATTTCAATTCTATCATAAAC 1 67 0 TATTTCATTC 0.983468 -34 GACATAATACTATTACAGTTTCTTTTCATTC 2 66 0 TATTACATTT 0.947046 -168 GAAAGTTCCCTTTTTCAATACACTTCATTAT 2 109 0 TTTTTCATAC 0.945202 -125 AACTTTCAGATTTTTCATCTTTTTACAAATG 2 133 1 TTTTTCACTT 0.934237 -101 CCTAATCTTTTATATCATTTTATCTATCACA 2 206 0 TATATCATTT 0.94704 -28 ******* *** Masking position 7 Map Score: 2.59002 Number of sites scoring better than the average of aligned sites = 892 Number in coding regions = 702 Number in noncoding regions = 190 Number of orfs with sites within 600 bp upstream = 212 Fraction of orfs with sites within 600 bp upstream = 0.0340508 Motif number 5 ********** No masking Map Score: -6.1574e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -6.1574e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -6.1574e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0