AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i253_chemotaxis2_bsub_reg_300.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 motA 300 motility protein A Motif number 1 AGCGCTACTTCCCTTCATCCTTTACACTTTTTTA 1 9 1 TTCCTCCTTA 0.998424 -292 TATAAACATGTTCCATCCCTCCTTAAAAAAGTGTAA 1 32 0 TTCATCCTTA 0.99535 -269 GCAGCTTGCTTGCAAGCTGTCCTTCAGATGGTATTC 1 98 0 TGCATCCTTA 0.989702 -203 TTCTCCCTTCTATGCCTCTTCCTTGAATATTTCATG 1 188 1 TATCTCCTTA 0.96752 -113 CATGAACAAATTCACAATGTCCCTAAAGTTCCGGGC 1 220 1 TTCCTCCCTA 0.995653 -81 AGTTTTCACCAAATCCTTTTTTACTAGCTT 1 281 0 TTCCTCCTTT 0.993642 -20 *** * ***** * Masking position 10 Map Score: 7.63302 Number of sites scoring better than the average of aligned sites = 163 Number in coding regions = 140 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 2 ATATTCACTGTATATAAACATGTTCCATCC 1 50 0 TATATAAACA 0.865046 -251 TATAATAGTAGAAATACATATTCACTGTAT 1 67 0 GAAATACATA 0.910579 -234 GGGGTCTACTGAAATTAGCAGCTTGCTTGC 1 121 0 GAAATTAGCA 0.964075 -180 ATAGAAGGGAGAAATAAACAAAAACGGGCT 1 171 0 GAAATAAACA 0.98961 -130 ATTTGTTCATGAAATATTCAAGGAAGAGGC 1 201 0 GAAATATTCA 0.875902 -100 ATTTCATGAACAAATTCACAATGTCCCTAA 1 216 1 CAAATTCACA 0.933116 -85 CACCAAAACCGATATTAACCATAGACAAGC 1 255 1 GATATTAACC 0.90758 -46 ********** Masking position 4 Map Score: 3.46279 Number of sites scoring better than the average of aligned sites = 671 Number in coding regions = 576 Number in noncoding regions = 95 Number of orfs with sites within 600 bp upstream = 100 Fraction of orfs with sites within 600 bp upstream = 0.0160617 Motif number 3 AGTAGACCCCCGGGCTTTTCAATTTTGGAGAG 1 141 1 CGGGCTTCAA 0.997388 -160 TAAACAAAAACGGGCTCTCCAAAATTGAAAAG 1 155 0 CGGGCTCCAA 0.99902 -146 CCTAAAGTTCCGGGCACCAAAACCGATATTAA 1 241 1 CGGGCACAAA 0.995413 -60 ******* *** Masking position 11 Map Score: 1.08321 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 7 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 AAATTAGCAGCTTGCTTGCAAGCTGTCCTT 1 110 0 CTTGCTTGCA 0.954442 -191 AGTAGACCCCCGGGCTTTTCAATTTTGGAG 1 141 1 CGGGCTTTTC 0.993233 -160 TAAACAAAAACGGGCTCTCCAAAATTGAAA 1 157 0 CGGGCTCTCC 0.99249 -144 TCCTTTTTTACTAGCTTGTCTATGGTTAAT 1 268 0 CTAGCTTGTC 0.981756 -33 ********** Masking position 6 Map Score: 0.617625 Number of sites scoring better than the average of aligned sites = 381 Number in coding regions = 343 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0