AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i276_hypothetical20_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yurN 57 similar to sugar permease #2 yurO 80 similar to multiple sugar-binding protein #3 yurP 215 similar to opine catabolism Motif number 1 GCATTAGACTATAATGTTATATAACATTAT 2 33 1 ATAATGTTAT 0.545742 -48 ACATTAGACTATAATGTTATATAACATTAT 2 43 0 ATAATGTTAT 0.545742 -38 ATAACATTATATATTGTTATATTAAAGTCC 3 161 0 ATATTGTTAT 0.810959 -55 ATAACAATATATAATGTTATATAACGTTAT 3 171 1 ATAATGTTAT 0.545742 -45 ATAATGTTATATAACGTTATATAATAAAAA 3 181 1 ATAACGTTAT 0.499972 -35 ********** Masking position 7 Map Score: 14.9567 Number of sites scoring better than the average of aligned sites = 13 Number in coding regions = 6 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 2 TGCGAAGCTTCACCTTTTCTTTGAT 1 4 0 CCTTTTCTTT 0.995366 -54 TGAAGCTTCGCACCTTTTCTTTTTATAAAGGA 1 24 1 CCTTTTCTTT 0.995366 -34 GGGTATCTCATCTCCTTTATAAAAAGAA 1 40 0 CCTCTCCTTT 0.990518 -18 CGCATATAGACCCTTTGTCTGTCATCCGAATA 3 84 1 CCTTGTCTGT 0.990518 -132 ATCCTTCACTCCTCGTTTTTATTATATAAC 3 196 0 CCTCGTTTTT 0.979579 -20 * * ******** Masking position 5 Map Score: 5.30838 Number of sites scoring better than the average of aligned sites = 227 Number in coding regions = 187 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 44 Fraction of orfs with sites within 600 bp upstream = 0.00706714 Motif number 3 GTTATATAACATTATAGTCTAATGCATAAT 2 28 0 ATTATAGTCT 0.993924 -53 GTTATATAACATTATAGTCTAATGTCCAGA 2 48 1 ATTATAGTCT 0.993924 -33 GATTGTCAATATTATTTTCTGAAATTTCTC 3 123 0 ATTATTTTCT 0.942366 -93 ATATTGTTATATTAAAGTCCGCGGGTAGGA 3 151 0 ATTAAAGTCC 0.974547 -65 ********** Masking position 4 Map Score: 4.47091 Number of sites scoring better than the average of aligned sites = 33 Number in coding regions = 28 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 TATAACATTATAGTCTAATGCATAATGGTT 2 24 0 TAGTCTAATG 0.992127 -57 TATAACATTATAGTCTAATGTCCAGAGGAG 2 52 1 TAGTCTAATG 0.992127 -29 CTCAATAATTTATTCGGATGACAGACAAAG 3 96 0 TATTCGGATG 0.952522 -120 ********** Masking position 8 Map Score: 1.64524 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 3 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 5 AGGGTTGGCCTCCTCTGGACA 2 70 0 AGGTTGGCCT 0.975687 -11 ACTTGACTTAAGCTCTGGCTTCGCTGTTCAA 3 27 0 AGTCTGGCTT 0.996712 -189 GCTTAAGTCAAGTTCTGGCTTTTGATTTGGG 3 45 1 AGTCTGGCTT 0.996712 -171 ** ******** Masking position 1 Map Score: 1.13593 Number of sites scoring better than the average of aligned sites = 25 Number in coding regions = 20 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 6 AGAAAAGGTGCGAAGCTTCACCTTTTCTTT 1 14 0 CGAAGCTTCA 0.899568 -44 CTGTTCAATCCGCAGACTGACGTC 3 5 0 CGCAGACTGA 0.989173 -211 GATTGAACAGCGAAGCCAGAGCTTAAGTCA 3 25 1 CGAAGCCAGA 0.995328 -191 TGCCCAAATCAAAAGCCAGAACTTGACTTA 3 48 0 AAAAGCCAGA 0.810772 -168 GGCATTTTTTCGCATATAGACCCTTTGTCT 3 74 1 CGCATATAGA 0.839096 -142 TAATTTATTCGGATGACAGACAAAGGGTCT 3 91 0 GGATGACAGA 0.909107 -125 ATAATAAAAACGAGGAGTGAAGGAT 3 201 1 CGAGGAGTGA 0.933772 -15 ********** Masking position 10 Map Score: 1.14915 Number of sites scoring better than the average of aligned sites = 1722 Number in coding regions = 1604 Number in noncoding regions = 118 Number of orfs with sites within 600 bp upstream = 89 Fraction of orfs with sites within 600 bp upstream = 0.0142949 Motif number 7 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -6.15168e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0