AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i291_hish_bsub_reg_300.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 guaB 120 inositol-monophosphate dehydrogenase #2 dacA 152 D-alanyl-D-alanine carboxypeptidase (penicillin-binding protein 5) #3 yaaD 196 similar to hypothetical proteins #4 yaaE 21 similar to hypothetical proteins Motif number 1 GTATATTTCTTAATCCTTTCCGTTATCTAA 1 11 1 TAATCCTTTC 0.79184 -110 CTAAATATTTCAACTCTTTCCCGCTTCCTT 1 37 1 CAACTCTTTC 0.95407 -84 ACAGAGTCAGAGACCCTGTCAAATGTTTTT 2 27 0 AGACCCTGTC 0.931804 -126 ACAGGGTCTCTGACTCTGTCTATTTTTTTT 2 38 1 TGACTCTGTC 0.97283 -115 AAGCCGTTAAGGACATTTTCAATGCACAAC 2 94 0 GGACATTTTC 0.913326 -59 ACATCCATCAGAGCTCTTTCAATTGA 3 7 0 GAGCTCTTTC 0.986237 -190 ATGGATGTTAGGGCTCTTTCGCGTAATATA 3 29 1 GGGCTCTTTC 0.994577 -168 ATTAAAAATTGGGTTTTTTCAGTATATTAC 3 51 0 GGGTTTTTTC 0.905618 -146 ********** Masking position 7 Map Score: 6.23583 Number of sites scoring better than the average of aligned sites = 866 Number in coding regions = 734 Number in noncoding regions = 132 Number of orfs with sites within 600 bp upstream = 89 Fraction of orfs with sites within 600 bp upstream = 0.0142949 Motif number 2 ATAATCTACATATAATATTTTGCCGAAAAG 1 87 1 TATAATATTT 0.877443 -34 CTATTTTTTTTATACTGATTATGATAAAAT 2 57 1 TATACTGATT 0.929199 -96 TGATAAAATTTATACTGTTGTGCATTGAAA 2 78 1 TATACTGTTG 0.906793 -75 TTTTATTAAAAATTGGGTTTTTTCAGTATA 3 55 0 AATTGGGTTT 0.876144 -142 TATACTATTTTATTCGGTTTTTAGCGCTTT 3 95 0 TATTCGGTTT 0.976981 -102 CATATGCATATATACTATTTTATTCGGTTT 3 105 0 TATACTATTT 0.95488 -92 GCATATGAATTATTGGATTTCTAGGATACA 3 128 1 TATTGGATTT 0.919372 -69 TCTAGGATACAATAAGGATTAGAAATCATA 3 147 1 AATAAGGATT 0.728683 -50 AAGGTATAGTTATATGATTTCTAATCCTTA 3 159 0 TATATGATTT 0.888625 -38 ********** Masking position 3 Map Score: 5.02932 Number of sites scoring better than the average of aligned sites = 726 Number in coding regions = 594 Number in noncoding regions = 132 Number of orfs with sites within 600 bp upstream = 144 Fraction of orfs with sites within 600 bp upstream = 0.0231288 Motif number 3 GTATATTTCTTAATCCTTTCCGTTA 1 6 1 TTTCTTAATC 0.98169 -115 CTCTTGGCTAGTTGATAATCTACATATAAT 1 73 1 GTTGATAATC 0.944352 -48 GTATAAATTTTATCATAATCAGTATAAAAA 2 63 0 TATCATAATC 0.957417 -90 CGTATTTCATTTTCTTCATCTATAATTAAG 2 121 0 TTTCTTCATC 0.95998 -32 TTTTTAGCGCTTTGAAAATCATTTTTTATT 3 78 0 TTTGAAAATC 0.940974 -119 ********** Masking position 3 Map Score: 2.0989 Number of sites scoring better than the average of aligned sites = 311 Number in coding regions = 264 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 51 Fraction of orfs with sites within 600 bp upstream = 0.00819146 Motif number 4 CATTTGACAGGGTCTCTGACTCTGTCTATT 2 32 1 GGTCTCTGAC 0.969853 -121 TCAATTGAAAGAGCTCTGATGGATGTTAGG 3 11 1 GAGCTCTGAT 0.993337 -186 TTACGCGAAAGAGCCCTAACATCCATCAGA 3 25 0 GAGCCCTAAC 0.976689 -172 ATAGTTATATGATTTCTAATCCTTATTGTA 3 154 0 GATTTCTAAT 0.849119 -43 GAACATAGGAGCGCTGCTGAC 4 9 1 GAGCGCTGCT 0.975245 -13 ********** Masking position 7 Map Score: 0.0273085 Number of sites scoring better than the average of aligned sites = 280 Number in coding regions = 247 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 5 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -8.99385e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0