AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i296_mixed11_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yqjC 201 similar to hypothetical proteins Motif number 1 GGCGCCTGCTTTTTTATCGTTATAGAAAC 1 8 1 GTTTTTTATG 0.991921 -194 GTGATTTTGGGAGTTTTTATTCTTTCAACTGT 1 58 0 GGTTTTTATC 0.987426 -144 CTGATGAAAAGCGTTTTGATCGTGATTTTGGG 1 79 0 GGTTTTGATG 0.996663 -123 AATATAGACAGATTGTTTAAGGAGAGAAAATC 1 123 0 GTTGTTTAAG 0.974735 -79 ATATTTTAGCGTGTTTTGAATGGGCGGACAAG 1 150 1 GGTTTTGAAG 0.995223 -52 * ******** * Masking position 6 Map Score: 5.75984 Number of sites scoring better than the average of aligned sites = 201 Number in coding regions = 157 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 2 TCGTTATAGAAACATGACGATTCCTGAGAG 1 27 1 AACATGACGA 0.989801 -175 AAAAACTCCCAAAATCACGATCAAAACGCT 1 72 1 AAAATCACGA 0.993992 -130 CATGTCTCAAAAACTGATGAAAAGCGTTTT 1 94 0 AAACTGATGA 0.984311 -108 TTAAGGAGAGAAAATCATGTCTCAAAAACT 1 109 0 AAAATCATGT 0.976917 -93 ********** Masking position 5 Map Score: 3.49952 Number of sites scoring better than the average of aligned sites = 248 Number in coding regions = 214 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 3 AAGAATAAAAACTCCCAAAATCACGATCAA 1 66 1 ACTCCCAAAA 0.970143 -136 TCCCAAAATCACGATCAAAACGCTTTTCAT 1 78 1 ACGATCAAAA 0.944693 -124 CCCATTCAAAACACGCTAAAATATAGACAG 1 144 0 ACACGCTAAA 0.979835 -58 GAATGGGCGGACAAGCGATATCTATTAGCG 1 167 1 ACAAGCGATA 0.974302 -35 AGCGATATCTATTAGCGAAAGCAGGGATGA 1 180 1 ATTAGCGAAA 0.93082 -22 ********** Masking position 8 Map Score: 0.88804 Number of sites scoring better than the average of aligned sites = 448 Number in coding regions = 395 Number in noncoding regions = 53 Number of orfs with sites within 600 bp upstream = 55 Fraction of orfs with sites within 600 bp upstream = 0.00883392 Motif number 4 TTTTTATCGTTATAGAAACATGACGATTCC 1 21 1 TATAGAAACA 0.97462 -181 TTTCATCAGTTTTTGAGACATGATTTTCTC 1 102 1 TTTTGAGACA 0.959278 -100 ACAGATTGTTTAAGGAGAGAAAATCATGTC 1 118 0 TAAGGAGAGA 0.972233 -84 CACGCTAAAATATAGACAGATTGTTTAAGG 1 133 0 TATAGACAGA 0.982625 -69 ********** Masking position 6 Map Score: 0.0498771 Number of sites scoring better than the average of aligned sites = 160 Number in coding regions = 129 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 5 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0