AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i302_mixed17_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ybfT 218 similar to glucosamine-6-phosphate isomerase #2 nagA 181 N-acetylglucosamine-6-phosphate deacetylase Motif number 1 GATTGCATACAGAATGGGGAGAATGAA 1 8 0 AGAATGGGGA 0.939369 -211 GTCTCAATGAAAAAGAACGGATTGCATACA 1 27 0 AAAAGAACGG 0.954386 -192 AATTTGTTATAAAAGAAGGATACAAATCTT 1 85 0 AAAAGAAGGA 0.955479 -134 TGACAGTTTGATAAGGGCGGTGCTAAATTC 1 130 1 ATAAGGGCGG 0.972823 -89 GGCAGCCCGGAACAGGAGGAACATATC 2 8 0 AACAGGAGGA 0.961423 -174 CAGATTTTATAAAAGGGGGGAAAACACCTC 2 91 1 AAAAGGGGGG 0.995782 -91 CACTAGTCTGAAAAAGAGTAAAATAAAGGT 2 134 1 AAAAAGAGTA 0.740821 -48 TTCAAATTCCAGAAAGGCGGATCATCT 2 165 1 AGAAAGGCGG 0.963814 -17 ********** Masking position 4 Map Score: 7.28354 Number of sites scoring better than the average of aligned sites = 1737 Number in coding regions = 1117 Number in noncoding regions = 620 Number of orfs with sites within 600 bp upstream = 627 Fraction of orfs with sites within 600 bp upstream = 0.100707 Motif number 2 AGAAGGATACAAATCTTTCATATTGGGAGGGC 1 70 0 AAATCTTATA 0.937916 -149 TAATTTCTGAAAATTTGTTATAAAAGAAGGAT 1 94 0 AAATTGTATA 0.989593 -125 AAATTTTCAGAAATTAATATTGACAGTTTGAT 1 110 1 AAATTATTTG 0.889965 -109 GGGCGGTGCTAAATTCGTAATGACAAGTATCA 1 144 1 AAATTGTATG 0.987444 -75 CAAGTATCATAAATTGGTCATAACAAATATGG 1 167 1 AAATTGTATA 0.989594 -52 CCCTTTTATAAAATCTGTTTTAGGTTCAAGCC 2 76 0 AAATCGTTTA 0.976875 -106 ***** ** *** Masking position 8 Map Score: 5.19096 Number of sites scoring better than the average of aligned sites = 128 Number in coding regions = 109 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 3 GCATACAGAATGGGGAGAATGAA 1 4 0 TGGGGAGAAT 0.967077 -215 TTCATATTGGGAGGGCAAATGGTATTATGG 1 56 0 GAGGGCAAAT 0.957552 -163 GCCCGGAACAGGAGGAACATATC 2 4 0 GGAGGAACAT 0.986112 -178 TTTATAAAAGGGGGGAAAACACCTCAGCTG 2 96 1 GGGGGAAAAC 0.991576 -86 ATTCCAGAAAGGCGGATCATCT 2 170 1 GGCGGATCAT 0.976553 -12 ********** Masking position 9 Map Score: 0.849423 Number of sites scoring better than the average of aligned sites = 347 Number in coding regions = 261 Number in noncoding regions = 86 Number of orfs with sites within 600 bp upstream = 107 Fraction of orfs with sites within 600 bp upstream = 0.017186 Motif number 4 ACAAATCTTTCATATTGGGAGGGCAAATGG 1 64 0 CATATTGGGA 0.912217 -155 TCTTTTATAACAAATTTTCAGAAATTAATA 1 99 1 CAAATTTTCA 0.942544 -120 CCGCCCTTATCAAACTGTCAATATTAATTT 1 120 0 CAAACTGTCA 0.9424 -99 TTGTCATTACGAATTTAGCACCGCCCTTAT 1 140 0 GAATTTAGCA 0.887377 -79 TTGTTATGACCAATTTATGATACTTGTCAT 1 163 0 CAATTTATGA 0.955878 -56 ACAATACTTTCATTTTATCACTTTCGGGCT 2 50 1 CATTTTATCA 0.956926 -132 ********** Masking position 6 Map Score: 0.0700314 Number of sites scoring better than the average of aligned sites = 717 Number in coding regions = 629 Number in noncoding regions = 88 Number of orfs with sites within 600 bp upstream = 93 Fraction of orfs with sites within 600 bp upstream = 0.0149374 Motif number 5 ********** No masking Map Score: 6.84553e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 6.84553e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 6.84553e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0