AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i314_mixed28_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 trpE 215 anthranilate synthase Motif number 1 GAAATACACAAGAGTGTGTATAAAGCAATTAG 1 29 1 AGAGTGTGTA 0.987819 -187 TAAAGCAATTAGAATGAGTTGAGTTAGAGAAT 1 49 1 AGAATGAGTA 0.997484 -167 AGGGTAGCAGAGAATGAGTTTAGTTGAGCTGA 1 81 1 AGAATGAGTA 0.997484 -135 ATGAGAAGATGGCATGAGAGGATAAAATACTA 1 168 0 GGCATGAGAA 0.991749 -48 TATGGCAAGGAGAATGAGAAGATGGCATGAGA 1 181 0 AGAATGAGAA 0.997484 -35 CTTGCCATAAGGAGTGAGAGCA 1 204 1 GGAGTGAGAA 0.996344 -12 ********* * Masking position 5 Map Score: 13.7774 Number of sites scoring better than the average of aligned sites = 69 Number in coding regions = 49 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 2 TTCTAAGCTGTTCTTATCGTA 1 2 0 TTCTTATCGT 0.974521 -214 ACTCAACTCATTCTAATTGCTTTATACACA 1 43 0 TTCTAATTGC 0.955348 -173 AAAGAAAGACTTCTTTTGGGTAGAATAAAC 1 121 0 TTCTTTTGGG 0.994879 -95 AAAGAAGTCTTTCTTTTGGGTTTATTTGTT 1 135 1 TTCTTTTGGG 0.994879 -81 TGCTCTCACTCCTTATGGCAAGGAGAATG 1 197 0 TCCTTATGGC 0.989977 -19 ********** Masking position 4 Map Score: 6.54901 Number of sites scoring better than the average of aligned sites = 200 Number in coding regions = 174 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 3 CCTATTCTCTAACTCAACTCATTCTAATTG 1 54 0 AACTCAACTC 0.980786 -162 TTCTCTGCTACCCTATTCTCTAACTCAACT 1 65 0 CCCTATTCTC 0.97729 -151 GTCTCAGCTCAACTAAACTCATTCTCTGCT 1 86 0 AACTAAACTC 0.983955 -130 GGTAGAATAAACATAATGTCTCAGCTCAAC 1 103 0 ACATAATGTC 0.933881 -113 ACTATATAACAAATAAACCCAAAAGAAAGA 1 142 0 AAATAAACCC 0.934744 -74 TCCTCTCATGCCATCTTCTCATTCTCCTTG 1 178 1 CCATCTTCTC 0.957792 -38 ********** Masking position 4 Map Score: 3.69081 Number of sites scoring better than the average of aligned sites = 388 Number in coding regions = 315 Number in noncoding regions = 73 Number of orfs with sites within 600 bp upstream = 72 Fraction of orfs with sites within 600 bp upstream = 0.0115644 Motif number 4 TTAGAGAATAGGGTAGCAGAGAATGAGTTT 1 72 1 GGGTAGCAGA 0.99516 -144 GACTTCTTTTGGGTAGAATAAACATAATGT 1 114 0 GGGTAGAATA 0.993716 -102 TGGCATGAGAGGATAAAATACTATATAACA 1 161 0 GGATAAAATA 0.93587 -55 CACTCCTTATGGCAAGGAGAATGAGAAGAT 1 190 0 GGCAAGGAGA 0.977885 -26 ********** Masking position 5 Map Score: 1.47428 Number of sites scoring better than the average of aligned sites = 113 Number in coding regions = 86 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 5 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0