AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i320_mixed5_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ndk 115 nucleoside diphosphate kinase #2 hisS 300 histidyl-tRNA synthetase Motif number 1 AGAAATTTCTCCGCCCCGGATTGATTAATTATCA 1 26 1 CCGCCCCGGA 0.996251 -90 ATTCTCCACCCCATCATTATGTATGTATA 1 97 0 CCACCCCTTA 0.992514 -19 AGAGAGGAACCCGCCCCAGGCTGAAAGCGGATCC 2 31 1 CCGCCCCGGA 0.982449 -270 ACCCGTGGTGCCACCCTAGTTGGAATACGTTCAT 2 170 0 CCACCCTGGA 0.995536 -131 AAAAAAACTCCCGCCCCTACTATACATGATAGTA 2 218 0 CCGCCCCATA 0.996664 -83 ******* * ** Masking position 14 Map Score: 9.09057 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 31 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 2 ATTAATCAATCCGGGGCGGAGAAATTTCTT 1 25 0 CCGGGGCGGA 0.99459 -91 ATACATAATGATGGGGTGGAGAAT 1 102 1 ATGGGGTGGA 0.987919 -14 CGCTTTCAGCCTGGGGCGGGTTCCTCTCTA 2 30 0 CTGGGGCGGG 0.99902 -271 GCGTTAAAGGATCGAGCGGGAATATGAACG 2 147 1 ATCGAGCGGG 0.959623 -154 CGTATTCCAACTAGGGTGGCACCACGGGTA 2 175 1 CTAGGGTGGC 0.967401 -126 TCATGTATAGTAGGGGCGGGAGTTTTTTTC 2 223 1 TAGGGGCGGG 0.989399 -78 ********** Masking position 6 Map Score: 8.36991 Number of sites scoring better than the average of aligned sites = 230 Number in coding regions = 190 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 GCATGATTAGAGAGGAACCCGCCCCAGGCT 2 23 1 AGAGGAACCC 0.965105 -278 CCAGGCTGAAAGCGGATCCCATTGCGTCTT 2 46 1 AGCGGATCCC 0.949063 -255 ACAACACTCCGGAGGTTTCCTGCTGAACGC 2 83 1 GGAGGTTTCC 0.98735 -218 ACTGCCTAATGGCGTTATTCACGCGTTCAG 2 105 0 GGCGTTATTC 0.834107 -196 ATCCTTTAACGCAGGTTCACGTTCACTGCC 2 129 0 GCAGGTTCAC 0.941427 -172 AGTAGGGACGAGAGTTATACCCGTGGTGCC 2 192 0 AGAGTTATAC 0.901404 -109 GAATACATAAGGAGGTCTACCT 2 289 1 GGAGGTCTAC 0.971914 -12 ********** Masking position 4 Map Score: 2.62816 Number of sites scoring better than the average of aligned sites = 842 Number in coding regions = 612 Number in noncoding regions = 230 Number of orfs with sites within 600 bp upstream = 200 Fraction of orfs with sites within 600 bp upstream = 0.0321234 Motif number 4 AACATCTTTCTGATAATTAATCAATCCGGG 1 40 0 TGATAATTAA 0.932851 -76 CATTAGGCAGTGAACGTGAACCTGCGTTAA 2 124 1 TGAACGTGAA 0.982782 -177 GGATCGAGCGGGAATATGAACGTATTCCAA 2 155 1 GGAATATGAA 0.9198 -146 TCGTTAATGATGAAAATGAAAAAAACTCCC 2 240 0 TGAAAATGAA 0.978103 -61 AAATATCCAATGATCGTTAATGATGAAAAT 2 253 0 TGATCGTTAA 0.9548 -48 ********** Masking position 7 Map Score: 1.93567 Number of sites scoring better than the average of aligned sites = 446 Number in coding regions = 394 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 61 Fraction of orfs with sites within 600 bp upstream = 0.00979762 Motif number 5 ********** No masking Map Score: -8.99957e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -8.99957e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -8.99957e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0