AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i326_not_clear1_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 lsp 102 signal peptidase II #2 yqfP 122 similar to penicillin tolerance Motif number 1 CCTGATATTTCTTTACTCCAGTGCTTTTTA 1 33 1 CTTTACTCCA 0.997222 -70 TTTACGGTTACTTTAATCCATTATGCATTT 1 69 0 CTTTAATCCA 0.991823 -34 AAACGTTCCTCCAGTTTACGGTT 1 90 0 CGTTCCTCCA 0.992596 -13 ATATAAAAAGCCGTAATCAAACGGCTCTAT 2 66 0 CCGTAATCAA 0.938679 -57 TTTATATTGCCTTTACTCACTTCAGTATTG 2 89 1 CTTTACTCAC 0.977951 -34 TTTCGGTTGTCCTCCAATACTGAAGT 2 107 0 TTGTCCTCCA 0.974417 -16 ********** Masking position 4 Map Score: 8.26563 Number of sites scoring better than the average of aligned sites = 370 Number in coding regions = 322 Number in noncoding regions = 48 Number of orfs with sites within 600 bp upstream = 54 Fraction of orfs with sites within 600 bp upstream = 0.00867331 Motif number 2 AGAAATATCAGGCATATTAACCGGACAGAC 1 15 0 GGCATATTAA 0.96985 -88 TTTACTCCAGTGCTTTTTATTGATAAAATG 1 44 1 TGCTTTTTAT 0.992537 -59 TAATCCATTATGCATTTTATCAATAAAAAG 1 56 0 TGCATTTTAT 0.992535 -47 GTTTGATTACGGCTTTTTATATTGCCTTTA 2 74 1 GGCTTTTTAT 0.995163 -49 ********** Masking position 5 Map Score: 6.0689 Number of sites scoring better than the average of aligned sites = 141 Number in coding regions = 106 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 3 TATAGCCAATCTCACTTAAGATATCAAAGA 2 14 0 CTCACTTAAG 0.969872 -109 TTCTTCTGATCTCATTATAGCCAATCTCAC 2 29 0 CTCATTATAG 0.977872 -94 ATTGCCTTTACTCACTTCAGTATTGGAGGA 2 94 1 CTCACTTCAG 0.97118 -29 ********** Masking position 4 Map Score: 2.44789 Number of sites scoring better than the average of aligned sites = 14 Number in coding regions = 12 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ATATTTCTTTACTCCAGTGCTTTTTATTGA 1 37 1 ACTCCAGTGC 0.992534 -66 CGGTTACTTTAATCCATTATGCATTTTATC 1 65 0 AATCCATTAT 0.906494 -38 AAACGTTCCTCCAGTTTACGGTTACTT 1 86 0 CCTCCAGTTT 0.989216 -17 TTTCGGTTGTCCTCCAATACTGAAGTGAGT 2 103 0 CCTCCAATAC 0.989266 -20 ********** Masking position 6 Map Score: 1.30053 Number of sites scoring better than the average of aligned sites = 223 Number in coding regions = 161 Number in noncoding regions = 62 Number of orfs with sites within 600 bp upstream = 59 Fraction of orfs with sites within 600 bp upstream = 0.00947639 Motif number 5 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.08538e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0