AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i333_1_5_3_1_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 tenA 248 transcriptional regulator Motif number 1 ACGAATACATATTGAATTGTTCTGCACCTC 1 43 0 ATTGAATTGT 0.824222 -206 AAGGGCTGAGATAAAAGTGTGACTTTTAGA 1 97 1 ATAAAAGTGT 0.939617 -152 AGACCTGCGTAGGGAAGTGGAGCGGTATTT 1 149 1 AGGGAAGTGG 0.996117 -100 GAAAAGTGGTTTGGAATTGGCATAGTAAAA 1 185 0 TTGGAATTGG 0.956179 -64 TTTCCCGCAAGGAAAAGTGGTTTGGAATTG 1 196 0 GGAAAAGTGG 0.98737 -53 TTTTCCTTGCGGGAAAGTGGTTTTTTTATT 1 210 1 GGGAAAGTGG 0.994355 -39 ********** Masking position 5 Map Score: 5.32504 Number of sites scoring better than the average of aligned sites = 612 Number in coding regions = 519 Number in noncoding regions = 93 Number of orfs with sites within 600 bp upstream = 78 Fraction of orfs with sites within 600 bp upstream = 0.0125281 Motif number 2 GTGTTAATATAGAGGTGCAGAACAATTCAA 1 32 1 AGAGGTGCAG 0.991637 -217 GGACACCCCTAGTGGTTAAACGAATACATA 1 62 0 AGTGGTTAAA 0.927904 -187 CATAACTTGAACAGGTTCAGACCTGCGTAG 1 131 1 ACAGGTTCAG 0.970408 -118 TGCGTAGGGAAGTGGAGCGGTATTTGTGTT 1 154 1 AGTGGAGCGG 0.98331 -95 CGCAAGGAAAAGTGGTTTGGAATTGGCATA 1 191 0 AGTGGTTTGG 0.992239 -58 CTTGCGGGAAAGTGGTTTTTTTATTTTCAG 1 215 1 AGTGGTTTTT 0.89982 -34 ********** Masking position 1 Map Score: 4.3591 Number of sites scoring better than the average of aligned sites = 381 Number in coding regions = 338 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 3 CTCTATATTAACACGAATCCTTATTTGGTC 1 16 0 ACACGAATCC 0.996544 -233 CCTAGTGGTTAAACGAATACATATTGAATT 1 55 0 AAACGAATAC 0.992113 -194 TAGTAAAATAACACAAATACCGCTCCACTT 1 163 0 ACACAAATAC 0.992113 -86 ********** Masking position 6 Map Score: 2.98958 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 7 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 TCTCAGCCCTTATGAAGGACACCCCTAGTG 1 78 0 TATGAAGGAC 0.992954 -171 CTGTTCAAGTTATGAGGGTCTAAAAGTCAC 1 115 0 TATGAGGGTC 0.995208 -134 TCCACTTCCCTACGCAGGTCTGAACCTGTT 1 140 0 TACGCAGGTC 0.993873 -109 ********** Masking position 2 Map Score: 1.85355 Number of sites scoring better than the average of aligned sites = 21 Number in coding regions = 19 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 CTGCACCTCTATATTAACACGAATCCTTAT 1 22 0 ATATTAACAC 0.962408 -227 TGAGGGTCTAAAAGTCACACTTTTATCTCA 1 103 0 AAAGTCACAC 0.982653 -146 TTGGCATAGTAAAATAACACAAATACCGCT 1 169 0 AAAATAACAC 0.99137 -80 TCTGAAAATAAAAAAACCACTTTCCCGCAA 1 216 0 AAAAAACCAC 0.963866 -33 ********** Masking position 3 Map Score: 1.81526 Number of sites scoring better than the average of aligned sites = 144 Number in coding regions = 99 Number in noncoding regions = 45 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 6 TATTGAATTGTTCTGCACCTCTATATTAAC 1 34 0 TTCTGCACCT 0.965642 -215 ACACTTTTATCTCAGCCCTTATGAAGGACA 1 87 0 CTCAGCCCTT 0.99074 -162 AAGTGTGACTTTTAGACCCTCATAACTTGA 1 111 1 TTTAGACCCT 0.978685 -138 CTTGAACAGGTTCAGACCTGCGTAGGGAAG 1 136 1 TTCAGACCTG 0.985751 -113 ********** Masking position 2 Map Score: 0.399286 Number of sites scoring better than the average of aligned sites = 448 Number in coding regions = 385 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 7 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0