AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i017_Glycolysis___PPS_ctra_reg_100.orf -o017_ctra_100.ace -a/home/amcguire/alignace/lib/ORF_ctra.txt -z/skink1/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCT00177 116 Chlamydia_trachomatis #2 RCT00178 24 Chlamydia_trachomatis #3 RCT00359 112 Chlamydia_trachomatis Motif number 1 AAAACATGGCTTTGCCATGAGGGATC 1 3 0 TTTCGAGGGA 0.982769 -114 GGCAAAGCCATGTTTTATGAGAGAGAAATCTTTT 1 21 1 TGTTGAGAGA 0.96612 -96 AAAACGAATATGTGCCTAAAAAGATTTCTCTCTC 1 39 0 TGTCAAAAGA 0.974813 -78 AGAGTGTTAATTTTTTAAGAGAGAGCCCACAATA 1 78 0 TTTTGAGAGA 0.962221 -39 TTTGTTTTGCAAGAGGTTGTATAC 2 3 1 TGTTAAGAGG 0.973431 -22 AGATAGTACAAGTAAAAAGAAAGAAGGTCTCTCG 3 63 1 AGTAGAAAGA 0.868799 -50 TTTGAGGAAATGTGATACGAGAGACCTTCTTTCT 3 80 0 TGTTGAGAGA 0.99728 -33 TCGTATCACATTTCCTCAAAAGGAGAATC 3 94 1 TTTTAAAGGA 0.928199 -19 *** * ****** Masking position 10 Map Score: 10.9902 Number of sites scoring better than the average of aligned sites = 215 Number in coding regions = 215 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 CCTCATGGCAAAGCCATGTTTTATGAGAGAG 1 15 1 AAGCCATTTT 0.977575 -102 TTAGGCACATATTCGTTTTTTTGGTATTGTG 1 54 1 ATTCGTTTTT 0.979156 -63 TTTGTAGAACAATCGATCTTTTCATCTA 3 8 0 AATCGATTTT 0.985175 -105 ATCTTTCGCGATTCCATTTTTGTAGAACAAT 3 26 0 ATTCCATTTT 0.9899 -87 GTGATACGAGAGACCTTCTTTCTTTTTACTT 3 72 0 AGACCTTTTT 0.957672 -41 ******* *** Masking position 7 Map Score: 3.53022 Number of sites scoring better than the average of aligned sites = 81 Number in coding regions = 80 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 AAGCCATGTTTTATGAGAGAGAAATCTTTT 1 25 1 TTATGAGAGA 0.982574 -92 TGTTAATTTTTTAAGAGAGAGCCCACAATA 1 78 0 TTAAGAGAGA 0.990052 -39 AAAAATGGAATCGCGAAAGATCACGAAAGA 3 36 1 TCGCGAAAGA 0.982289 -77 TCGCGAAAGATCACGAAAGATAGTACAAGT 3 46 1 TCACGAAAGA 0.993286 -67 AGTACAAGTAAAAAGAAAGAAGGTCTCTCG 3 67 1 AAAAGAAAGA 0.930691 -46 AGGAAATGTGATACGAGAGACCTTCTTTCT 3 80 0 ATACGAGAGA 0.991748 -33 ********** Masking position 6 Map Score: 10.0997 Number of sites scoring better than the average of aligned sites = 78 Number in coding regions = 78 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 GATACAACCTAGTATAGAGT 1 107 0 GATACAACCT 0.992881 -10 GTATACAACCTCTTGCAAAAC 2 14 0 TATACAACCT 0.994009 -11 TCTTTTTACTTGTACTATCTTTCGTGATCT 3 53 0 TGTACTATCT 0.966662 -60 ********** Masking position 4 Map Score: 0.775568 Number of sites scoring better than the average of aligned sites = 5 Number in coding regions = 5 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 TTCGTTTTTTTGGTATTGTGGGCTCTCTCT 1 65 1 TGGTATTGTG 0.991241 -52 TCTACAAAAATGGAATCGCGAAAGATCACG 3 31 1 TGGAATCGCG 0.992351 -82 TCTCCTTTTGAGGAAATGTGATACGAGAGA 3 90 0 AGGAAATGTG 0.984697 -23 ********** Masking position 5 Map Score: 0.0330168 Number of sites scoring better than the average of aligned sites = 16 Number in coding regions = 16 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0