AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i043_5_1_3_1_ctra_reg_300.orf -o043_ctra_300.ace -a/home/amcguire/alignace/lib/ORF_ctra.txt -z/skink1/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCT00118 300 Chlamydia_trachomatis Motif number 1 TCTGCATATAGGACAGAGTAGAACATGTTGCAT 1 26 1 GAAGAGAGAA 0.993511 -275 ATTCTTGTCTGCGCAGTGCAGAATCGCTTTGGG 1 102 1 GGAGTGAGAA 0.961902 -199 TGAAATGTATGTAAAGAGAAAAGGAGGATAGAG 1 147 1 GAAGAGAAAG 0.992017 -154 GAGAAAAGGAGGATAGAGGGAAACTCTTAGTTC 1 162 1 GAAGAGGAAA 0.993511 -139 ACGATAAGAAGGAGAGTGTACAATGGCAATTAT 1 202 0 GAAGTGACAA 0.978064 -99 CCTTCTTATCGTAGAGGGTTAAAATTTTTGACC 1 223 1 GAAGGGTAAA 0.961956 -78 TCTACAGAAGGAAATGAGAGAAGAGGCC 1 283 1 GATGAGGAAG 0.955334 -18 * * **** **** Masking position 12 Map Score: 5.96139 Number of sites scoring better than the average of aligned sites = 151 Number in coding regions = 151 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 TTTCGTATCGCCAATGCAACATGTTCTACT 1 42 0 CCAATGCAAC 0.974764 -259 ATTGGCGATACGAAAGCACTGATTGCTATG 1 57 1 CGAAAGCACT 0.973267 -244 TTGAATCCCTCCATAGCAATCAGTGCTTTC 1 68 0 CCATAGCAAT 0.99343 -233 CAGGCACACCCCAAAGCGATTCTGCACTGC 1 114 0 CCAAAGCGAT 0.989858 -187 GGAGAGTGTACAATGGCAATTATTTTTGGG 1 195 0 CAATGGCAAT 0.957123 -106 ********** Masking position 3 Map Score: 3.6503 Number of sites scoring better than the average of aligned sites = 72 Number in coding regions = 72 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 TTCTGCATATAGGACAGAGTAGAACATGTTG 1 25 1 AGGAAGAGTA 0.992969 -276 GTGAAATGTATGTAAAGAGAAAAGGAGGATA 1 146 1 TGTAAGAGAA 0.935506 -155 AGAGAAAAGGAGGATAGAGGGAAACTCTTAG 1 161 1 AGGAAGAGGG 0.991479 -140 TACGATAAGAAGGAGAGTGTACAATGGCAAT 1 205 0 AGGAAGTGTA 0.972101 -96 CATTTCCTTCTGTAGAGATGACGCACATACA 1 268 0 TGTAAGATGA 0.916968 -33 ACAGAAGGAAATGAGAGAAGAGGCC 1 286 1 ATGAAGAAGA 0.904156 -15 **** ****** Masking position 6 Map Score: 2.80573 Number of sites scoring better than the average of aligned sites = 265 Number in coding regions = 265 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 TGTCCTATATGCAGAAATTGATCGTTAATC 1 11 0 GCAGAAATTG 0.925045 -290 CGATACGAAAGCACTGATTGCTATGGAGGG 1 62 1 GCACTGATTG 0.959706 -239 TGCCTGTCGTGAAATGTATGTAAAGAGAAA 1 138 1 GAAATGTATG 0.948196 -163 TAGTTCCCCAAAAATAATTGCCATTGTACA 1 189 1 AAAATAATTG 0.769444 -112 CCACAAGATTGAAGTGTATGTGCGTCATCT 1 254 1 GAAGTGTATG 0.97634 -47 CATCTCTACAGAAGGAAATGAGAGAAGAGG 1 279 1 GAAGGAAATG 0.956641 -22 ********** Masking position 3 Map Score: 0.538995 Number of sites scoring better than the average of aligned sites = 331 Number in coding regions = 331 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0