AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i060_Diaminopimelate_Pathway_ctra_reg_100.orf -o060_ctra_100.ace -a/home/amcguire/alignace/lib/ORF_ctra.txt -z/skink1/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCT00346 236 Chlamydia_trachomatis Motif number 1 TAATTTATTTAGAGAAAGAACTTTAGATGT 1 28 0 AGAGAAAGAA 0.973268 -209 ATAAATTAGGAAAAAGAGCAAGTTTGCGAA 1 50 1 AAAAAGAGCA 0.986568 -187 TAGCTCCAACAGGAAAAGCAAAGCAAATTC 1 77 0 AGGAAAAGCA 0.987545 -160 AAAATGGCTAAAAGAAACCACTGCAGCAGT 1 125 0 AAAGAAACCA 0.980387 -112 TAGTATTATGAAAAAAAGCATAGGCCTTGT 1 201 1 AAAAAAAGCA 0.993904 -36 ********** Masking position 5 Map Score: 6.03567 Number of sites scoring better than the average of aligned sites = 166 Number in coding regions = 166 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 AGTGAGTAAATAGCTCCAACAGGAAAAGCA 1 87 0 TAGCTCCAAC 0.987396 -150 GTGGAACCTATAGGATCCTCTTAGAAAATG 1 149 0 TAGGATCCTC 0.926219 -88 GAGGATCCTATAGGTTCCACAATGGTGGAT 1 159 1 TAGGTTCCAC 0.988263 -78 TATCAGCAACTCTCATCCACCATTGTGGAA 1 173 0 TCTCATCCAC 0.974368 -64 TTCATAATACTATCAGCAACTCTCATCCAC 1 183 0 TATCAGCAAC 0.964376 -54 CCTCCCAGTATCTCCGACAAGGCCTATG 1 219 0 TATCTCCGAC 0.976677 -18 ********** Masking position 1 Map Score: 4.48805 Number of sites scoring better than the average of aligned sites = 151 Number in coding regions = 151 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 CTTTGCTTTTCCTGTTGGAGCTATTTACTC 1 84 1 CCTGTTGGAG 0.997857 -153 CTTATACTATACTGCTGCAGTGGTTTCTTT 1 115 1 ACTGCTGCAG 0.987387 -122 AAGCATAGGCCTTGTCGGAGATACTGGGAG 1 216 1 CTTGTCGGAG 0.993019 -21 ********** Masking position 9 Map Score: 0.35619 Number of sites scoring better than the average of aligned sites = 47 Number in coding regions = 47 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 TTCTCTAAATAAATTAGGAAAAAGAGCAAGT 1 42 1 AAATTGGAAA 0.983897 -195 AAAGCAAAGCAAATTCGCAAACTTGCTCTTT 1 62 0 AAATTGCAAA 0.983897 -175 AGTATAGTATAAGTGAGTAAATAGCTCCAAC 1 97 0 AAGTGGTAAA 0.985065 -140 TCCTCTTAGAAAATGGCTAAAAGAAACCACT 1 133 0 AAATGCTAAA 0.976715 -104 ***** ***** Masking position 4 Map Score: 0.309707 Number of sites scoring better than the average of aligned sites = 42 Number in coding regions = 42 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0