AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i113_Amino_Acid_Transport_4_ctra_reg_100.orf -o113_ctra_100.ace -a/home/amcguire/alignace/lib/ORF_ctra.txt -z/skink1/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCT00704 104 Chlamydia_trachomatis Motif number 1 TCTAAAGGCCCCCTTTCCCCGGATAGGAGA 1 18 1 CCCTTTCCCC 0.998664 -87 TACAAAAGCCCCCTTTCTCCTATCCGGGGA 1 33 0 CCCTTTCTCC 0.994714 -72 GGGGCTTTTGTATTTTCCGCTTATTTGCCT 1 51 1 TATTTTCCGC 0.98669 -54 ATTTTCCGCTTATTTGCCTCCGAAGCGGGT 1 62 1 TATTTGCCTC 0.957505 -43 ACTACTCTTATGCTTTCACCCGCTTCGGAG 1 79 0 TGCTTTCACC 0.989553 -26 ********** Masking position 5 Map Score: 6.41243 Number of sites scoring better than the average of aligned sites = 175 Number in coding regions = 175 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 GGCCATTCTAAAGGCCCCCTTTCCCCGGAT 1 12 1 AAGGCCCCCT 0.85482 -93 GGAAAATACAAAAGCCCCCTTTCTCCTATC 1 39 0 AAAGCCCCCT 0.982291 -66 ********** Masking position 2 Map Score: 3.65893 Number of sites scoring better than the average of aligned sites = 1 Number in coding regions = 1 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 AGCCCCCTTTCTCCTATCCGGGGAAAGGGG 1 27 0 CTCCTATCCG 0.986962 -78 GCTTCGGAGGCAAATAAGCGGAAAATACAA 1 58 0 CAAATAAGCG 0.904695 -47 GCTTATTTGCCTCCGAAGCGGGTGAAAGCA 1 69 1 CTCCGAAGCG 0.986203 -36 TGTCCTACTACTCTTATGCTTTCACCCGCT 1 85 0 CTCTTATGCT 0.936755 -20 ********** Masking position 6 Map Score: 3.31472 Number of sites scoring better than the average of aligned sites = 84 Number in coding regions = 84 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0