AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i166_Nitrate_Transport_ctra_reg_300.orf -o166_ctra_300.ace -a/home/amcguire/alignace/lib/ORF_ctra.txt -z/skink1/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCT00172 300 Chlamydia_trachomatis #2 RCT00816 52 Chlamydia_trachomatis Motif number 1 AATGGATTTTTTCTGTGCGAAAGA 1 1 0 TTCTGCAAGA 0.981978 -300 CCAAGAGCGATTTTAAGCACAAGAAAAGATTATC 1 38 0 TTTTGCAAGA 0.849762 -263 CTTAAAATCGCTCTTGGATTAAGATGGCGCTTTG 1 55 1 CTCTGAAAGA 0.952652 -246 ATTAAGATGGCGCTTTGTTACTGAGAATCTTCGG 1 72 1 CGCTGTCTGA 0.944963 -229 AGATTCGAACTCCTGACCTTCTGAATGCAAATCA 1 150 0 TCCTCCCTGA 0.975335 -151 CAGTGTCGCGCTCTAACCAACTGAGCTATAACCG 1 201 0 CTCTCCCTGA 0.995135 -100 ATGCTCTCTTCCCCTATGATTCTTCCTTC 2 6 1 CTCTCCATGA 0.995229 -47 TCCCCTATGATTCTTCCTTCATGAAGTCGTTTTT 2 20 1 TTCTCTATGA 0.972891 -33 **** ** **** Masking position 14 Map Score: 6.17476 Number of sites scoring better than the average of aligned sites = 152 Number in coding regions = 152 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 CTTGAGAGCGGCTGTTACCGAAGATTCTCA 1 93 0 GCTGTTACCG 0.994463 -208 CAAATCAGATGCTCTACCAACTAAGCTAAG 1 127 0 GCTCTACCAA 0.953658 -174 AACCAACTGAGCTATAACCGCAGGGATGGA 1 191 0 GCTATAACCG 0.989512 -110 TCAGTGTCGCGCTCTAACCAACTGAGCTAT 1 206 0 GCTCTAACCA 0.995823 -95 TTCTGGACTTGCGGTTACCAAGACTTGAAC 1 253 0 GCGGTTACCA 0.986832 -48 ********** Masking position 5 Map Score: 5.44868 Number of sites scoring better than the average of aligned sites = 52 Number in coding regions = 52 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 AAGATTATCAAAAATGGATTTTTTCTGTGCGA 1 15 0 AAATGGATTT 0.662773 -286 ATCTTAATCCAAGAGCGATTTTAAGCACAAGA 1 48 0 AAGGCGATTT 0.935456 -253 AGAAGGTCAGGAGTTCGAATCTCCTAGTCTCC 1 162 1 GAGTCGATCT 0.987122 -139 TATAACCGCAGGGATGGAGACTAGGAGATTCG 1 177 0 GGGTGGAACT 0.92759 -124 CAGTTGGTTAGAGCGCGACACTGATAATGTCG 1 212 1 GAGGCGAACT 0.987172 -89 TTGAACTTGGGACCTCGACATTATCAGTGTCG 1 227 0 GACTCGAATT 0.947679 -74 TCGAGGTCCCAAGTTCAAGTCTTGGTAACCGC 1 241 1 AAGTCAATCT 0.898988 -60 CTTCCTTCATGAAGTCGTTTTTTCTATTTTT 2 32 1 GAATCGTTTT 0.848685 -21 *** **** *** Masking position 12 Map Score: 2.882 Number of sites scoring better than the average of aligned sites = 263 Number in coding regions = 261 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 ATCTTAATCCAAGAGCGATTTTAAGCACAA 1 50 0 AAGAGCGATT 0.909397 -251 AAGTCCCCTTGAGAGCGGCTGTTACCGAAG 1 100 0 GAGAGCGGCT 0.989599 -201 AGAAGGTCAGGAGTTCGAATCTCCTAGTCT 1 162 1 GAGTTCGAAT 0.930861 -139 CAGTTGGTTAGAGCGCGACACTGATAATGT 1 212 1 GAGCGCGACA 0.995594 -89 TTGAACTTGGGACCTCGACATTATCAGTGT 1 229 0 GACCTCGACA 0.966562 -72 ********** Masking position 2 Map Score: 0.859526 Number of sites scoring better than the average of aligned sites = 87 Number in coding regions = 87 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0