AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i174_Biotin_Biosynthesis_ctra_reg_300.orf -o174_ctra_300.ace -a/home/amcguire/alignace/lib/ORF_ctra.txt -z/skink1/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCT00118 300 Chlamydia_trachomatis Motif number 1 GCATATAGGACAGAGTAGAACATGTTGCAT 1 29 1 CAGAGTAGAA 0.979971 -272 GCTATGGAGGGATTCAAGAAAATTCTTGTC 1 81 1 GATTCAAGAA 0.947292 -220 CTGCACTGCGCAGACAAGAATTTTCTTGAA 1 93 0 CAGACAAGAA 0.974697 -208 CTTGTCTGCGCAGTGCAGAATCGCTTTGGG 1 105 1 CAGTGCAGAA 0.981537 -196 ATAAGAAGGAGAGTGTACAATGGCAATTAT 1 202 0 GAGTGTACAA 0.941466 -99 TTGACCACAAGATTGAAGTGTATGTGCGTC 1 250 1 GATTGAAGTG 0.856095 -51 AGAAGGAAATGAGAGAAGAGGCC 1 288 1 GAGAGAAGAG 0.987758 -13 ********** Masking position 7 Map Score: 5.55769 Number of sites scoring better than the average of aligned sites = 354 Number in coding regions = 352 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 TTGCATTGGCGATACGAAAGCACTGATTGC 1 53 1 GATACGAAAG 0.948327 -248 AGCACTGATTGCTATGGAGGGATTCAAGAA 1 71 1 GCTATGGAGG 0.968248 -230 TGCCTGTCGTGAAATGTATGTAAAGAGAAA 1 138 1 GAAATGTATG 0.973698 -163 TATGTAAAGAGAAAAGGAGGATAGAGGGAA 1 154 1 GAAAAGGAGG 0.985751 -147 AACCCTCTACGATAAGAAGGAGAGTGTACA 1 213 0 GATAAGAAGG 0.980083 -88 CCACAAGATTGAAGTGTATGTGCGTCATCT 1 254 1 GAAGTGTATG 0.919328 -47 TCTACAGAAGGAAATGAGAGAAGAGGCC 1 283 1 GAAATGAGAG 0.942295 -18 ********** Masking position 6 Map Score: 5.5444 Number of sites scoring better than the average of aligned sites = 215 Number in coding regions = 215 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 AATTTTCTTGAATCCCTCCATAGCAATCAG 1 75 0 AATCCCTCCA 0.937841 -226 CTATCCTCCTTTTCTCTTTACATACATTTC 1 148 0 TTTCTCTTTA 0.851541 -153 GAACTAAGAGTTTCCCTCTATCCTCCTTTT 1 165 0 TTTCCCTCTA 0.995845 -136 CATTGTACACTCTCCTTCTTATCGTAGAGG 1 210 1 TCTCCTTCTT 0.935226 -91 TCAAAAATTTTAACCCTCTACGATAAGAAG 1 224 0 TAACCCTCTA 0.976335 -77 TCTTCTCTCATTTCCTTCTGTAGAGATGAC 1 277 0 TTTCCTTCTG 0.97332 -24 ********** Masking position 7 Map Score: 2.96343 Number of sites scoring better than the average of aligned sites = 329 Number in coding regions = 329 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0