AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i191_dna_gyrase_ctra_reg_300.orf -o191_ctra_300.ace -a/home/amcguire/alignace/lib/ORF_ctra.txt -z/skink1/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCT00631 300 Chlamydia_trachomatis Motif number 1 ATATTGGTATAAAAATACGAAACAAAGAGA 1 20 0 AAAAATACGA 0.914854 -281 AGAGAGTCTCAAAAATATTGGTATAAAAAT 1 34 0 AAAAATATTG 0.963682 -267 TCTGCATTGAAAAAATTTTGTAGTCTGGAG 1 70 1 AAAAATTTTG 0.923833 -231 GAAGACTAAAAGAAATACTACGCCTTACAT 1 189 1 AGAAATACTA 0.914854 -112 CTCTCTTTAGAAAAATAATGTAAGGCGTAG 1 206 0 AAAAATAATG 0.965071 -95 ACAATCAGCTAATAGTTATGCTCTCTTTAG 1 226 0 AATAGTTATG 0.738624 -75 TTGTTTTCTCAGAAATTATAGAACCCGAAT 1 252 1 AGAAATTATA 0.908329 -49 GGAATAAGGCAAAAGTTTGATTCGGGTTCT 1 271 0 AAAAGTTTGA 0.849243 -30 ********** Masking position 4 Map Score: 5.47198 Number of sites scoring better than the average of aligned sites = 361 Number in coding regions = 361 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 TGGTATAAAAATACGAAACAAAGAGAATGAG 1 15 0 ATACGAAACA 0.967254 -286 TTTCGTCTCCAGACTACAAAATTTTTTCAAT 1 75 0 AGACTACAAA 0.982462 -226 TGTAGTCTGGAGACGAAAATAGAAAAACCGT 1 88 1 AGACGAAAAA 0.982465 -213 AGGACTTGAGATACTAAGATTAAGCCGTGGA 1 132 0 ATACTAAGAT 0.94995 -169 GTGAGACAGAAGACTAAAAGAAATACTACGC 1 181 1 AGACTAAAAA 0.985419 -120 ACTAAAAGAAATACTACGCCTTACATTATTT 1 193 1 ATACTACGCT 0.92523 -108 ********* * Masking position 6 Map Score: 3.98002 Number of sites scoring better than the average of aligned sites = 53 Number in coding regions = 52 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 TTGGCTCATTCTCTTTGTTTC 1 2 1 TGGCTCATTC 0.974156 -299 GCCGTGGAAACGCCTTTTTTAACGGTTTTT 1 110 0 CGCCTTTTTT 0.918145 -191 GGCGTTTCCACGGCTTAATCTTAGTATCTC 1 126 1 CGGCTTAATC 0.981568 -175 CAAGTCCTCACCGCTCACACTGCTTAGTGA 1 155 1 CCGCTCACAC 0.936702 -146 AGAAATACTACGCCTTACATTATTTTTCTA 1 199 1 CGCCTTACAT 0.963377 -102 ATCAAACTTTTGCCTTATTCCACACACTCT 1 280 1 TGCCTTATTC 0.978479 -21 ********** Masking position 5 Map Score: 2.4572 Number of sites scoring better than the average of aligned sites = 138 Number in coding regions = 138 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 TTGGCTCATTCTCTTTGTTTCGTAT 1 6 1 TCATTCTCTT 0.965886 -295 AATATTTTTGAGACTCTCTTCGTTCTCTGC 1 45 1 AGACTCTCTT 0.993566 -256 GCTAATAGTTATGCTCTCTTTAGAAAAATA 1 219 0 ATGCTCTCTT 0.983885 -82 GCCTTATTCCACACACTCTT 1 291 1 ACACACTCTT 0.991188 -10 ********** Masking position 7 Map Score: 2.2247 Number of sites scoring better than the average of aligned sites = 97 Number in coding regions = 97 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0