AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i234_sensory_cassete_ctra_reg_300.orf -o234_ctra_300.ace -a/home/amcguire/alignace/lib/ORF_ctra.txt -z/skink1/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCT00600 178 Chlamydia_trachomatis Motif number 1 TTTCTCTCAAATTTTTCGATC 1 1 1 TTTCTTCAAA 0.989791 -178 CTCTCAAATTTTTCGATCAAAAACTAGATAA 1 14 1 TTTCGTCAAA 0.968591 -165 CTCATTCTCTGCTTTATCTAGTTTTTGATCG 1 27 0 GCTTTTCTAG 0.915939 -152 GAGAATGAGCTGTTTATCACAGAACAAGTGT 1 49 1 TGTTTTCACA 0.952825 -130 ATCTTCAGACTTTTTTTCAAGTTTAGACTAC 1 78 0 TTTTTTCAAG 0.990244 -101 AGATATCGGTTTTTTTTCTGAGGCTCTTTGA 1 105 1 TTTTTTCTGA 0.960094 -74 AACAAAAATAGTTTTTTCAAAGAGCCTCAGA 1 121 0 GTTTTTCAAA 0.990244 -58 ***** ***** Masking position 7 Map Score: 6.6427 Number of sites scoring better than the average of aligned sites = 236 Number in coding regions = 236 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 AAGCAGAGAATGAGCTGTTTATCACAGAACA 1 44 1 TGAGTGTTTA 0.940143 -135 ACCGATATCTTCAGACTTTTTTTCAAGTTTA 1 84 0 TCAGCTTTTT 0.988381 -95 TCTGAAGATATCGGTTTTTTTTCTGAGGCTC 1 100 1 TCGGTTTTTT 0.988395 -79 GTTTTTTTTCTGAGGCTCTTTGAAAAAACTA 1 113 1 TGAGCTCTTT 0.986417 -66 AATAGTTCAATGGGTTTATTTAT 1 166 1 TGGGTTATTT 0.98004 -13 **** ****** Masking position 9 Map Score: 2.52012 Number of sites scoring better than the average of aligned sites = 114 Number in coding regions = 114 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0