AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i299_mixed14_ctra_reg_100.orf -o299_ctra_100.ace -a/home/amcguire/alignace/lib/ORF_ctra.txt -z/skink1/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCT00579 80 Chlamydia_trachomatis #2 RCT00626 300 Chlamydia_trachomatis Motif number 1 CTCCTTAATCTAAGGCATAGAGTATATGCA 1 16 1 TAAGGCATAG 0.986861 -65 AATCGAAGTCTAAGGTATAGTATCTTCCAG 2 31 0 TAAGGTATAG 0.980696 -270 AGGAATAGAAGAAGGAAGAGTGCTTCCAGA 2 62 0 GAAGGAAGAG 0.980906 -239 ACAAGCATCTCAAGGAATAGAAGAAGGAAG 2 74 0 CAAGGAATAG 0.997319 -227 GGGTTATGGGCAAGGATTCGGCGGATTAGC 2 111 0 CAAGGATTCG 0.976634 -190 ATAGTGAATCCAAGGAATGGGTTATGGGCA 2 129 0 CAAGGAATGG 0.994108 -172 ********** Masking position 3 Map Score: 9.17922 Number of sites scoring better than the average of aligned sites = 45 Number in coding regions = 45 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 GTATATGCATTCTCGAAAATTTTCTTCGAACCCGA 1 37 1 TCTGAAATCT 0.973125 -44 GACTTCGATTTTCTGGAAGCACTCTTCCTTCTTCT 2 51 1 TTCGAAGTCT 0.973542 -250 GGATTAGCAGTTTGAACAAGCATCTCAAGGAATAG 2 84 0 TTTACAATCT 0.983022 -217 CTATTTCCTCTTTAAAAAACCTTCTTCCTAGGATT 2 155 1 TTTAAAATCT 0.97957 -146 CTTCCTAGGATTTTATAAGGTTTCTCGTACCAATC 2 178 1 TTTAAAGTCT 0.983022 -123 GCAAATGGTGTATAGTCAAATTTCTGTCAGCTGAG 2 217 1 TATGCAATCT 0.967215 -84 GAATTGTGCCTTTAGTCAGAGTTCTTAACGATCTT 2 252 0 TTTGCAGTCT 0.993123 -49 *** * *** *** Masking position 8 Map Score: 6.4599 Number of sites scoring better than the average of aligned sites = 55 Number in coding regions = 55 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 CCTTAGATTAAGGAGAGTGT 1 1 0 AGGAGAGTGT 0.866563 -80 TCGGGTTCGAAGAAAATTTTCGAGAATGCA 1 42 0 AGAAAATTTT 0.760191 -39 AAGGAAACACTTCCATAGTGC 2 2 1 AGGAAACACT 0.945235 -299 CCATAGTGCTGGAAGATACTATACCTTAGA 2 23 1 GGAAGATACT 0.845931 -278 GAGTGCTTCCAGAAAATCGAAGTCTAAGGT 2 45 0 AGAAAATCGA 0.8865 -256 TTTTTTAAAGAGGAAATAGTGAATCCAAGG 2 144 0 AGGAAATAGT 0.968144 -157 GAGAAACCTTATAAAATCCTAGGAAGAAGG 2 174 0 ATAAAATCCT 0.822911 -127 CTGTCAGCTGAGAAGATCGTTAAGAACTCT 2 240 1 AGAAGATCGT 0.975854 -61 ACTCTAAAAAAGGATACCCTTTT 2 288 1 AGGATACCCT 0.675422 -13 ********** Masking position 6 Map Score: 3.38932 Number of sites scoring better than the average of aligned sites = 768 Number in coding regions = 765 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 ATATATTTTCGGGTTCGAAGAAAATTTTCG 1 50 0 GGGTTCGAAG 0.987197 -31 GTGCTTCCAGAAAATCGAAGTCTAAGGTAT 2 43 0 AAAATCGAAG 0.92205 -258 AGCATCTCAAGGAATAGAAGAAGGAAGAGT 2 71 0 GGAATAGAAG 0.990897 -230 AGGATTCGGCGGATTAGCAGTTTGAACAAG 2 99 0 GGATTAGCAG 0.971608 -202 GAGGAAATAGTGAATCCAAGGAATGGGTTA 2 135 0 TGAATCCAAG 0.946038 -166 ********** Masking position 5 Map Score: 1.24507 Number of sites scoring better than the average of aligned sites = 155 Number in coding regions = 155 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -6.79689e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -6.79689e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -6.79689e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0