AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i327_not_clear2_ctra_reg_100.orf -o327_ctra_100.ace -a/home/amcguire/alignace/lib/ORF_ctra.txt -z/skink1/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCT00063 185 Chlamydia_trachomatis Motif number 1 TTTTAGAGAATTTTTAGAAAGTCTTA 1 7 0 TTTTTAGAAA 0.512792 -179 ACGGGGCTTCTTTTTAGAGAATTTTTAGAA 1 18 0 TTTTTAGAGA 0.646591 -168 GGCGAGGGGATTTTTAAAGACAAAAGAAAA 1 65 0 TTTTTAAAGA 0.574906 -121 CCCCTCGCCTTTTTTATAAACTCTTCTAGA 1 86 1 TTTTTATAAA 0.568978 -100 GTGAGTTGTCTATCTAGAGAAAAGTAATCT 1 119 0 TATCTAGAGA 0.706657 -67 ********** Masking position 5 Map Score: 9.49622 Number of sites scoring better than the average of aligned sites = 83 Number in coding regions = 83 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 GCTTCTTTTTAGAGAATTTTTAGAAAGTCT 1 13 0 AGAGAATTTT 0.931967 -173 CCGAGATAGAACGGGGCTTCTTTTTAGAGA 1 28 0 ACGGGGCTTC 0.990334 -158 TCTATCTCGGACGGGGCTTTTCTTTTGTCT 1 48 1 ACGGGGCTTT 0.996292 -138 AAAAAAGGCGAGGGGATTTTTAAAGACAAA 1 71 0 AGGGGATTTT 0.991184 -115 GGACATGTTAACGGAATTGTGAGTTGTCTA 1 137 0 ACGGAATTGT 0.980298 -49 TGTTTTTAACCGAGTTTTTGCTTCGAAA 1 168 0 ACCGAGTTTT 0.983891 -18 ********** Masking position 8 Map Score: 8.4516 Number of sites scoring better than the average of aligned sites = 102 Number in coding regions = 102 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 CGTCCGAGATAGAACGGGGCTTCTTTTTAG 1 31 0 AGAACGGGGC 0.997881 -155 CGTTCTATCTCGGACGGGGCTTTTCTTTTG 1 45 1 CGGACGGGGC 0.999074 -141 GTTTTTGCTTCGAAAAGGACATGTTAACGG 1 153 0 CGAAAAGGAC 0.984455 -33 ********** Masking position 4 Map Score: 2.37633 Number of sites scoring better than the average of aligned sites = 7 Number in coding regions = 7 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0