AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i008_Uracil_Utilization_synecho_reg_300.orf -o008_synecho_300.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY18164 234 Synechocystis Motif number 1 CTGTCGTTGAACTTGGGGGAAATCCCTGCC 1 24 1 ACTTGGGGGA 0.997483 -211 TTTCTGCCATACTTTGGGCAGGGATTTCCC 1 40 0 ACTTTGGGCA 0.994581 -195 GGTTACCGGAAGTTGGGGCATTGGGAAGGG 1 76 0 AGTTGGGGCA 0.99863 -159 TAATCTTGGCCGTTGGGGAACCGAAAAATG 1 176 0 CGTTGGGGAA 0.993664 -59 ********** Masking position 4 Map Score: 7.15921 Number of sites scoring better than the average of aligned sites = 144 Number in coding regions = 116 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 2 ACGACAGACAGGCAAGCATT 1 1 0 GGCAAGCATT 0.995111 -234 CCATACTTTGGGCAGGGATTTCCCCCAAGT 1 34 0 GGCAGGGATT 0.992568 -201 CATTGGGAAGGGAAAGGTTTTCTGCCATAC 1 58 0 GGAAAGGTTT 0.989227 -177 GTTCCCCAACGGCCAAGATTAACAAAATTA 1 185 1 GGCCAAGATT 0.983409 -50 GGGAAAACTTAAAAGTTAATA 1 224 0 GGAAAACTTA 0.894784 -11 ********** Masking position 9 Map Score: 4.61388 Number of sites scoring better than the average of aligned sites = 688 Number in coding regions = 587 Number in noncoding regions = 101 Number of orfs with sites within 600 bp upstream = 100 Fraction of orfs with sites within 600 bp upstream = 0.0160617 Motif number 3 TGCCATACTTTGGGCAGGGATTTCCCCCAA 1 36 0 TGGGCAGGGA 0.989092 -199 GTTGGGGCATTGGGAAGGGAAAGGTTTTCT 1 65 0 TGGGAAGGGA 0.990808 -170 AGCTCAGATCGGGTTACCGGAAGTTGGGGC 1 87 0 GGGTTACCGG 0.980096 -148 CCGCGGTGAATTGTTACCGACGGTGAGACC 1 128 1 TTGTTACCGA 0.930683 -107 CTTGGCCGTTGGGGAACCGAAAAATGGGCT 1 172 0 GGGGAACCGA 0.994396 -63 ********** Masking position 6 Map Score: 3.74778 Number of sites scoring better than the average of aligned sites = 776 Number in coding regions = 707 Number in noncoding regions = 69 Number of orfs with sites within 600 bp upstream = 73 Fraction of orfs with sites within 600 bp upstream = 0.011725 Motif number 4 GAGACCACGTCCTAACTTTTAGCCCATTTT 1 152 1 CCTAACTTTT 0.984944 -83 GATTAACAAAATTAAATTTTAGATATTAAC 1 201 1 ATTAAATTTT 0.97132 -34 AATTTTAGATATTAACTTTTAAGTTTTCCC 1 215 1 ATTAACTTTT 0.989239 -20 ********** Masking position 5 Map Score: 1.12465 Number of sites scoring better than the average of aligned sites = 114 Number in coding regions = 79 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 5 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.46258e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0