AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i033_Pyruvate_Synthase_1_synecho_reg_300.orf -o033_synecho_300.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY19932 300 Synechocystis Motif number 1 TAATTTTTCCTAACTTTTTCTA 1 3 1 ATTTTTCCTA 0.985437 -298 ATTTTTCCTAACTTTTTCTAAGTTGCGGGT 1 13 1 ACTTTTTCTA 0.965797 -288 CACACCCAGGTTTTTTTCTATGGTTTAGAT 1 79 1 TTTTTTTCTA 0.988989 -222 AGTTATGGCGTTTTTTCCGAAAGGAAATTC 1 195 1 TTTTTTCCGA 0.990536 -106 GACAATATTATTTTTTTCGACTTTACGGAG 1 254 1 TTTTTTTCGA 0.989791 -47 ********** Masking position 5 Map Score: 8.26702 Number of sites scoring better than the average of aligned sites = 124 Number in coding regions = 88 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 2 CCACTGGCCTACCCGCAACTTAGAAAAAGTTAG 1 20 0 ACCCAACTAG 0.98393 -281 GGTAAAGCGAATCTAAACCATAGAAAAAAACCT 1 86 0 ACTAACCTAG 0.855172 -215 GGTTTAGATTCGCTTTACCTTTGCTTTAAGCTC 1 100 1 CCTTACCTTG 0.954415 -201 CAAGAAAAACCGCTTCAACAGAGCTTAAAGCAA 1 120 0 CCTCAACGAG 0.976953 -181 TCGGAAAAAACGCCATAACTTCAAATTCTGTTA 1 182 0 CCCTAACTCA 0.971522 -119 GGCTAGTTTACCCCACACCTGAATTTCCTTTCG 1 212 0 CCCCACCGAA 0.983285 -89 ACCGAGGGTTCTCCGTAAAGTCGAAAAAAATAA 1 261 0 CCCTAAATCG 0.815503 -40 TGACTATCGGCTCCTTAACCGAGGGTTCTCCGT 1 278 0 CCCTAACGAG 0.964488 -23 * ** **** *** Masking position 7 Map Score: 5.52561 Number of sites scoring better than the average of aligned sites = 1594 Number in coding regions = 1411 Number in noncoding regions = 183 Number of orfs with sites within 600 bp upstream = 170 Fraction of orfs with sites within 600 bp upstream = 0.0273049 Motif number 3 AGTGGCGATCGCCGCCAGTCTAACTTTTGT 1 48 1 GCCGCCAGTC 0.994857 -253 TTGGTTACAAGCTCAAAGTCACTCTAAAGA 1 150 1 GCTCAAAGTC 0.98261 -151 GGGTAAACTAGCCCATAATCCTGACAATAT 1 232 1 GCCCATAATC 0.98815 -69 CGGTTAAGGAGCCGATAGTCA 1 290 1 GCCGATAGTC 0.989512 -11 ********** Masking position 7 Map Score: 4.16292 Number of sites scoring better than the average of aligned sites = 97 Number in coding regions = 88 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 4 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0