AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i038_Galactose_Metabolism__synecho_reg_100.orf -o038_synecho_100.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY32056 160 Synechocystis #2 RCY16440 38 Synechocystis #3 RCY42175 94 Synechocystis Motif number 1 AAGTAGAAATATTTTTATTTTAATCATTCG 1 45 0 ATTTTTATTT 0.94848 -116 AAATAAAAATATTTCTACTTTGCTTTAAAA 1 55 1 ATTTCTACTT 0.98355 -106 ATGCTCTGACATTGCTACTTATTGCGGCTC 1 93 1 ATTGCTACTT 0.989476 -68 ATTGATAGTGATTTCAATTTATAAATGAGA 1 133 1 ATTTCAATTT 0.920358 -28 TTAGGAATTCTCATTTATAAATTGAA 1 145 0 ATTCTCATTT 0.89953 -16 AATTGATTAGATTGCCTCTTGAAGAAACCC 2 17 0 ATTGCCTCTT 0.971354 -22 AATTGTTTGTTGCGTGGCCAT 3 84 0 ATTGTTTGTT 0.880775 -11 ********** Masking position 1 Map Score: 6.05255 Number of sites scoring better than the average of aligned sites = 471 Number in coding regions = 393 Number in noncoding regions = 78 Number of orfs with sites within 600 bp upstream = 76 Fraction of orfs with sites within 600 bp upstream = 0.0122069 Motif number 2 TAACCAAGTAGGCCATGGCAGTTCAGCGAAT 1 19 1 GGCCAGGCAG 0.996133 -142 AAAAAGCTAAGGTCAAGCAAGGTTAAGAATG 3 11 1 GGTCAGCAAG 0.996618 -84 GTATGCTCTAGGCGAGGCAACAGCTTGGGTT 3 42 1 GGCGAGCAAC 0.997619 -53 AGTCGACAATGGCCACGCAACAAACAATT 3 76 1 GGCCAGCAAC 0.99911 -19 ***** ***** Masking position 5 Map Score: 5.23707 Number of sites scoring better than the average of aligned sites = 36 Number in coding regions = 32 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 AATAATTTTAACCAAGTAGGCCATGGCA 1 9 1 TAACCAAGTA 0.990951 -152 CTTGCTTTTAAAGCAAAGTAGAAATATTTT 1 60 0 AAGCAAAGTA 0.932455 -101 CTTTGCTTTAAAAGCAAGTATATGCTCTGA 1 72 1 AAAGCAAGTA 0.983505 -89 CCTCTTGAAGAAACCCATTAAA 2 3 0 AAACCCATTA 0.96954 -36 AGAGGCAATCTAATCAATTAA 2 28 1 TAATCAATTA 0.89104 -11 ********** Masking position 7 Map Score: 2.45559 Number of sites scoring better than the average of aligned sites = 393 Number in coding regions = 338 Number in noncoding regions = 55 Number of orfs with sites within 600 bp upstream = 55 Fraction of orfs with sites within 600 bp upstream = 0.00883392 Motif number 4 TGGCCTACTTGGTTAAAATTATT 1 4 0 GGTTAAAATT 0.989798 -157 TTCAGCGAATGATTAAAATAAAAATATTTC 1 40 1 GATTAAAATA 0.906348 -121 GGTCAAGCAAGGTTAAGAATGGTATGCTCT 3 21 1 GGTTAAGAAT 0.97898 -74 CAACAGCTTGGGTTAATAGTCGACAATGGC 3 59 1 GGTTAATAGT 0.97898 -36 ********** Masking position 5 Map Score: 1.29482 Number of sites scoring better than the average of aligned sites = 247 Number in coding regions = 208 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 5 AGTAGGCCATGGCAGTTCAGCGAATGATTA 1 25 1 GGCAGTTCAG 0.983348 -136 AAGTAGCAATGTCAGAGCATATACTTGCTT 1 83 0 GTCAGAGCAT 0.991999 -78 CAATAAAGAAGTCAGAGCCGCAATAAGTAG 1 107 0 GTCAGAGCCG 0.996493 -54 ********** Masking position 4 Map Score: 0.311567 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 87 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0