AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i041_Ribose_Metabolism_1_synecho_reg_100.orf -o041_synecho_100.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY48931 211 Synechocystis Motif number 1 TGCTAAAATAAACAATAGTTAATCGAGGT 1 9 0 AACAATGTTA 0.988504 -203 AATTAGCACTGGCATTAATTAGTAGCGATGA 1 49 0 GGCATTATTA 0.982303 -163 GGATGGAAACGACGTTTATTATGGTCAGTTT 1 109 0 GACGTTATTA 0.982302 -103 TGGCTTGACTGACAATGGTTAGATTAATTTA 1 142 0 GACAATGTTA 0.994865 -70 GCCCTAGGATAACATTCGTTATAAAGTGGAA 1 177 1 AACATTGTTA 0.991949 -35 ****** **** Masking position 6 Map Score: 6.22882 Number of sites scoring better than the average of aligned sites = 107 Number in coding regions = 92 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 TAATTAAGCAGTGATATTGCTATTATTTTG 1 75 1 GTGATATTGC 0.974374 -137 GTTTATTATGGTCAGTTTGCGCCAAAATAA 1 97 0 GTCAGTTTGC 0.995716 -115 TGTCAGTCAAGCCATTCTGCCCTAGGATAA 1 159 1 GCCATTCTGC 0.979908 -53 AGTGGAATCCGTGAGGTTGCA 1 201 1 GTGAGGTTGC 0.995003 -11 ********** Masking position 4 Map Score: 3.84343 Number of sites scoring better than the average of aligned sites = 144 Number in coding regions = 134 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 3 TAACTATTGTTTATTTTAGCAATCCTCTCG 1 19 1 TTATTTTAGC 0.99272 -193 AATGCCAGTGCTAATTAAGCAGTGATATTG 1 64 1 CTAATTAAGC 0.928728 -148 GATATTGCTATTATTTTGGCGCAAACTGAC 1 87 1 TTATTTTGGC 0.993253 -125 GAAACGACGTTTATTATGGTCAGTTTGCGC 1 105 0 TTATTATGGT 0.895549 -107 AATGGTTAGATTAATTTACCGGATGGAAAC 1 130 0 TTAATTTACC 0.964323 -82 ********** Masking position 5 Map Score: 3.61791 Number of sites scoring better than the average of aligned sites = 624 Number in coding regions = 524 Number in noncoding regions = 100 Number of orfs with sites within 600 bp upstream = 112 Fraction of orfs with sites within 600 bp upstream = 0.0179891 Motif number 4 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0