AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i043_5_1_3_1_synecho_reg_300.orf -o043_synecho_300.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY26949 128 Synechocystis #2 RCY50715 18 Synechocystis #3 RCY18596 20 Synechocystis #4 RCY10850 106 Synechocystis #5 RCY43048 300 Synechocystis Motif number 1 TTTAGGTTCCCATTGGTTCTAATAGGCTATTT 1 28 1 CATTGGTTAA 0.934564 -101 GCTTGAAATTCAGTGTAAACAATTACGGTCAA 1 96 0 CAGTGTACAA 0.982678 -33 AATCACTCCACAGTGGATTCACGGGGAAATTT 5 33 0 CAGTGGACAC 0.992906 -268 TACTTTTGCGCATTGTACTCACCAGCTTGACA 5 74 1 CATTGTACAC 0.969343 -227 TCCCATTGGTCATTGGCAGTAATATCGCTCAA 5 171 0 CATTGGCTAA 0.974972 -130 TGTGTTTAGGCATTGGAGCCAAATGCCTAAGT 5 202 0 CATTGGACAA 0.994228 -99 GGAATAAATGCAGTGGCATCGAAAATTAAAGG 5 278 0 CAGTGGCCGA 0.981502 -23 ******* *** Masking position 2 Map Score: 7.5518 Number of sites scoring better than the average of aligned sites = 475 Number in coding regions = 438 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 2 TTTGCTACAGTAAACACTACAGAAGCCTTGT 4 55 1 TAACACTACA 0.985227 -52 CAATTATTGTTAAGCAAAACATCGACGCATT 4 86 1 TAACAAAACA 0.933207 -21 TTTTCACTTTTGAACAATCCATT 5 3 0 TGACAATCCA 0.920387 -298 TACTTTTTCGTAATCACTCCACAGTGGATTC 5 45 0 TAACACTCCA 0.992792 -256 CCAACAGAGTAAAGCGCACCAAATGGTAGCC 5 136 0 AAACGCACCA 0.95398 -165 ATATCGCTCAAAATCCCAACAGAGTAAAGCG 5 151 0 AAACCCAACA 0.909395 -150 GATTCTAATTCAACCACTCCAGGCGTTGGGC 5 244 0 CAACACTCCA 0.984139 -57 *** ******* Masking position 3 Map Score: 4.94987 Number of sites scoring better than the average of aligned sites = 328 Number in coding regions = 283 Number in noncoding regions = 45 Number of orfs with sites within 600 bp upstream = 51 Fraction of orfs with sites within 600 bp upstream = 0.00819146 Motif number 3 TTTAAAGGCCGGGTTTGGGGGCCTACTACA 1 65 1 GGGTTTGGGG 0.993174 -64 GGGACTAGGGGTTAACCA 2 2 1 GGACTAGGGG 0.980898 -17 GATGCGGAGGTGGGGATTTCTGGGC 4 6 1 GGAGGTGGGG 0.987053 -101 ATGACCAATGGGACTTAGGCATTTGGCTCC 5 190 1 GGACTTAGGC 0.985966 -111 GGGTAAGATTGTGTTTAGGCATTGGAGCCA 5 213 0 GTGTTTAGGC 0.883795 -88 AACCACTCCAGGCGTTGGGCTGGGTAAGAT 5 234 0 GGCGTTGGGC 0.991801 -67 ********** Masking position 8 Map Score: 4.63071 Number of sites scoring better than the average of aligned sites = 1279 Number in coding regions = 1150 Number in noncoding regions = 129 Number of orfs with sites within 600 bp upstream = 136 Fraction of orfs with sites within 600 bp upstream = 0.0218439 Motif number 4 CTCTCGCCCCCAGATGGTTGCCCAGAAATCCCC 4 22 0 CAAGGTGCCC 0.998359 -85 TTTACTGTAGCAAACTCTCGCCCCCAGATGGTT 4 36 0 CAATCTGCCC 0.997465 -71 TAAAGCGCACCAAATGGTAGCCCAGACAAAGGC 5 125 0 CAAGGTGCCC 0.99836 -176 AATGCCTAAACACAATCTTACCCAGCCCAACGC 5 220 1 CAATCTACCC 0.990003 -81 ** * *** **** Masking position 8 Map Score: 3.76893 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 36 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 5 CCCAAACCCGGCCTTTAAAATAGGAAATAG 1 54 0 GCCTTTAAAA 0.925721 -75 GCCTGGATAATGAATCAATC 3 1 1 GCCTGGATAA 0.964026 -20 CCAGATGGTTGCCCAGAAATCCCCACCTCC 4 16 0 GCCCAGAAAT 0.919702 -91 CACTACAGAAGCCTTGTCAATTATTGTTAA 4 69 1 GCCTTGTCAA 0.955465 -38 CCAAATGGTAGCCCAGACAAAGGCAGAACA 5 119 0 GCCCAGACAA 0.983486 -182 AATTAGAATCGCCCCTTTAATTTTCGATGC 5 265 1 GCCCCTTTAA 0.876048 -36 AAATGCAGTGGCATCGAAAATTAAAGGGGC 5 275 0 GCATCGAAAA 0.901633 -26 ********** Masking position 9 Map Score: 2.18104 Number of sites scoring better than the average of aligned sites = 1335 Number in coding regions = 1209 Number in noncoding regions = 126 Number of orfs with sites within 600 bp upstream = 129 Fraction of orfs with sites within 600 bp upstream = 0.0207196 Motif number 6 TTCTGGGCAACCATCTGGGGGCGAGAGTTT 4 28 1 CCATCTGGGG 0.996368 -79 TCAGGGCTGTCAAGCTGGTGAGTACAATGC 5 83 0 CAAGCTGGTG 0.985423 -218 CAGAACAAGACAATCAGGGCTGTCAAGCTG 5 96 0 CAATCAGGGC 0.963414 -205 GTCTGGGCTACCATTTGGTGCGCTTTACTC 5 131 1 CCATTTGGTG 0.978154 -170 ********** Masking position 3 Map Score: 0.806957 Number of sites scoring better than the average of aligned sites = 341 Number in coding regions = 314 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 7 ********** No masking Map Score: 7.69818e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 7.69818e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 7.69818e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0