AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i055_Arginine_Metabolism_synecho_reg_300.orf -o055_synecho_300.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY34497 112 Synechocystis #2 RCY24958 106 Synechocystis Motif number 1 CATCACTGCCATCCCCCCAAGACCATTAACCGAGT 1 18 1 ATCCCCGCCA 0.999103 -95 GATCGAATTAAGCCCCATTTTGCCATACTCGGTTA 1 44 0 AGCCCCTCCA 0.996102 -69 AATTCGATCGATGTTAATTCGACCACCACATTGGA 1 70 1 ATGTTAGCCA 0.941453 -43 AGCCGTTATCCCCGATTGTCCAATGTGGTGGT 1 91 0 ATCCCCGCCA 0.999106 -22 GTATCGGAAAATCTTCAAGATCCCAAGGAAAGATT 2 20 0 ATCTTCTCCA 0.996544 -87 TCAAACCTCCATCTTCGTCATCTCAATTTAATTT 2 83 1 ATCTTCTTCA 0.978074 -24 ****** * *** Masking position 1 Map Score: 6.98163 Number of sites scoring better than the average of aligned sites = 586 Number in coding regions = 518 Number in noncoding regions = 68 Number of orfs with sites within 600 bp upstream = 65 Fraction of orfs with sites within 600 bp upstream = 0.0104401 Motif number 2 ATCACTGCCATCCCCCCAAGACCATTAACCGAGT 1 19 1 TCCCCAGCCA 0.998549 -94 ATCGAATTAAGCCCCATTTTGCCATACTCGGTTA 1 44 0 GCCCCTTCCA 0.995414 -69 AGCCGTTATCCCCGATTGTCCAATGTGGTGGT 1 91 0 TCCCCTGCCA 0.998068 -22 TATCGGAAAATCTTCAAGATCCCAAGGAAAGATT 2 20 0 TCTTCATCCA 0.992703 -87 CAAACCTCCATCTTCGTCATCTCAATTTAATTT 2 84 1 TCTTCATTCA 0.963075 -23 ***** ** *** Masking position 14 Map Score: 4.06497 Number of sites scoring better than the average of aligned sites = 512 Number in coding regions = 451 Number in noncoding regions = 61 Number of orfs with sites within 600 bp upstream = 64 Fraction of orfs with sites within 600 bp upstream = 0.0102795 Motif number 3 AATTAACATCGATCGAATTAAGCCCCATTT 1 59 0 GATCGAATTA 0.994997 -54 CCAATGTGGTGGTCGAATTAACATCGATCG 1 74 0 GGTCGAATTA 0.996622 -39 ********** Masking position 6 Map Score: 0.891555 Number of sites scoring better than the average of aligned sites = 6 Number in coding regions = 3 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 ********** No masking Map Score: 4.28758e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 4.28758e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 4.28758e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0