AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i119_Spermidine_putrescine_Transport_synecho_reg_100.orf -o119_synecho_100.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY38580 145 Synechocystis Motif number 1 GCAAATAATTCTTATTTAAAGTACCGTTTA 1 29 1 CTTATTTAAA 0.952596 -117 TATTTAAAGTACCGTTTAAATACTTGCTTT 1 41 1 ACCGTTTAAA 0.996901 -105 TCAGATCTAAACTGTTTAAAGCAAGTATTT 1 58 0 ACTGTTTAAA 0.995211 -88 GAGGACTGATCCCGTTTAAAACTCAGACCT 1 91 0 CCCGTTTAAA 0.997994 -55 ********** Masking position 5 Map Score: 7.30763 Number of sites scoring better than the average of aligned sites = 57 Number in coding regions = 48 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 2 AAAACTCAGACCTGATTCAGATCTAAACTG 1 74 0 CCTGATTCAG 0.995056 -72 TAGTGGGAGGACTGATCCCGTTTAAAACTC 1 97 0 ACTGATCCCG 0.9893 -49 CTTTTTTGCCCCTGGTTCCT 1 136 1 CCTGGTTCCT 0.995259 -10 ********** Masking position 6 Map Score: 1.97122 Number of sites scoring better than the average of aligned sites = 118 Number in coding regions = 111 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 3 TTTAAACAGTTTAGATCTGAATCAGGTCTG 1 68 1 TTAGATCTGA 0.524906 -78 TAGATCTGAATCAGGTCTGAGTTTTAAACG 1 79 1 TCAGGTCTGA 0.512155 -67 AACAATAGTGGGAGGACTGATCCCGTTTAA 1 102 0 GGAGGACTGA 0.970916 -44 ********** Masking position 3 Map Score: 1.75149 Number of sites scoring better than the average of aligned sites = 28 Number in coding regions = 19 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 4 TGTTAACCTTAACTCTTGCAAATAATTCTT 1 12 1 AACTCTTGCA 0.984017 -134 TCTTGCAAATAATTCTTATTTAAAGTACCG 1 25 1 AATTCTTATT 0.942334 -121 GTACCGTTTAAATACTTGCTTTAAACAGTT 1 49 1 AATACTTGCT 0.989445 -97 GTCCTCCCACTATTGTTGCTGCTTTTTTGC 1 115 1 TATTGTTGCT 0.975271 -31 ********** Masking position 6 Map Score: 1.3804 Number of sites scoring better than the average of aligned sites = 382 Number in coding regions = 317 Number in noncoding regions = 65 Number of orfs with sites within 600 bp upstream = 74 Fraction of orfs with sites within 600 bp upstream = 0.0118856 Motif number 5 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.43208e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0