AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i270_hypothetical15_synecho_reg_300.orf -o270_synecho_300.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY52916 300 Synechocystis #2 RCY27405 123 Synechocystis Motif number 1 ACTTTTGTAGGCTTTCGCCGACATTT 1 7 0 GCTTTCGCCG 0.956559 -294 GTTTCATTTTCCTATCCCTGTCGTGACAAT 1 54 0 CCTATCCCTG 0.97845 -247 AGTTGCCGCTCCTTTCCTCCCTGAACCGAT 1 140 1 CCTTTCCTCC 0.912106 -161 AGTTGATGCCGTTTACCGTGGTCTGGGTTC 1 199 1 GTTTACCGTG 0.914547 -102 CGGGGTGATTGCGAACCCAGACCACGGTAA 1 211 0 GCGAACCCAG 0.921435 -90 ACCCCTTTCACTTTACCCAGGAAATACGGA 1 272 1 CTTTACCCAG 0.965948 -29 AGTTTACCGTCCGTATTTCCT 1 290 0 GTTTACCGTC 0.878706 -11 AACCCCGACGGTTATCCCACTCAGGCAATT 2 36 0 GTTATCCCAC 0.942014 -88 GCTTAACCGAACTAACCCCGACGGTTATCC 2 49 0 ACTAACCCCG 0.947283 -75 CGGTTAAGCACCTTTCCCCCAATCCACCGT 2 70 1 CCTTTCCCCC 0.989354 -54 ********** Masking position 6 Map Score: 8.41941 Number of sites scoring better than the average of aligned sites = 3873 Number in coding regions = 3427 Number in noncoding regions = 446 Number of orfs with sites within 600 bp upstream = 438 Fraction of orfs with sites within 600 bp upstream = 0.0703501 Motif number 2 TCGGCGAAAGCCTACAAAAGTTAGGAACATTTTGG 1 16 1 CCTACAAGGG 0.970215 -285 GTGGCGAGGAGCTACTAAGGTCAGGCCCTTTCTTT 1 103 0 GCTACAGGGG 0.998568 -198 AAATATTCTTGCTAGATTGGCAGGTTCATCGGTTC 1 162 0 GCTAGTGGGT 0.962312 -139 GTTGATGCCGTTTACCGTGGTCTGGGTTCGCAATC 1 200 1 TTTACTGGGG 0.965557 -101 AACTAGTGTTGCTACCAAAGCCGGGGTGATTGCGA 1 227 0 GCTACAAGGG 0.995455 -74 TTGACTAGATCCTACGGTGGATTGGGGGAAAGGTG 2 78 0 CCTACTGGGG 0.996749 -46 ***** *** ** Masking position 4 Map Score: 5.86162 Number of sites scoring better than the average of aligned sites = 264 Number in coding regions = 236 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 3 CAATTTACCAAAATGTTCCTAACTTTTGTAGGC 1 25 0 AAAGTCCAAC 0.9817 -276 ACCGAAAAAGAAAGGGCCTGACCTTAGTAGCTC 1 97 1 AAAGGCTACC 0.991795 -204 AGACCACGGTAAACGGCATCAACTGCAAATATT 1 190 0 AAAGGATAAC 0.991673 -111 TGAAAGGGGTCAATGGGATGAACTAGTGTTGCT 1 249 0 CAAGGATAAC 0.981702 -52 GGATTGGGGGAAAGGTGCTTAACCGAACTAACC 2 62 0 AAAGTCTAAC 0.991673 -62 *** ** ** *** Masking position 3 Map Score: 2.45265 Number of sites scoring better than the average of aligned sites = 62 Number in coding regions = 53 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 TTAGGAACATTTTGGTAAATTGTCACGACA 1 36 1 TTTGGTAAAT 0.880385 -265 GAAAATGAAACTCGGTCATTATTGACCGAA 1 73 1 CTCGGTCATT 0.962063 -228 CCCTTTCTTTTTCGGTCAATAATGACCGAG 1 83 0 TTCGGTCAAT 0.988915 -218 GAACCCAGACCACGGTAAACGGCATCAACT 1 199 0 CACGGTAAAC 0.93042 -102 TCCGTATTTCCTGGGTAAAGTGAAAGGGGT 1 272 0 CTGGGTAAAG 0.934816 -29 GGTTATCCCACTCAGGCAATTCTTAACATC 2 27 0 CTCAGGCAAT 0.829801 -97 TCGGGGTTAGTTCGGTTAAGCACCTTTCCC 2 58 1 TTCGGTTAAG 0.970435 -66 AGGCCTCGATTTCCGTTAAC 2 114 1 TTCCGTTAAC 0.86323 -10 ********** Masking position 8 Map Score: 2.96761 Number of sites scoring better than the average of aligned sites = 1009 Number in coding regions = 871 Number in noncoding regions = 138 Number of orfs with sites within 600 bp upstream = 154 Fraction of orfs with sites within 600 bp upstream = 0.024735 Motif number 5 GGAGCTACTAAGGTCAGGCCCTTTCTTTTT 1 101 0 AGGTCAGGCC 0.991704 -200 GAATATTTGCAGTTGATGCCGTTTACCGTG 1 189 1 AGTTGATGCC 0.992473 -112 TAGCAACACTAGTTCATCCCATTGACCCCT 1 248 1 AGTTCATCCC 0.980075 -53 GTTAACGGAAATCGAGGCCTGTTGACTAG 2 105 0 AATCGAGGCC 0.967859 -19 ********** Masking position 6 Map Score: 0.99119 Number of sites scoring better than the average of aligned sites = 143 Number in coding regions = 128 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 6 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0