AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i300_mixed15_synecho_reg_100.orf -o300_synecho_100.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY43837 121 Synechocystis #2 RCY26609 38 Synechocystis #3 RCY32578 235 Synechocystis Motif number 1 TTCTGCCAATTGTGCAAGTTCCGCAAGCAAGTAGAGC 1 17 0 TGAAGTTAAG 0.985494 -105 TTGCACAATTGGCAGAAGTTTAACTAACGGGCGAATT 1 37 1 GGAAGTTTAA 0.942837 -85 TTTAACTAACGGGCGAATTTGTTAAAGGCACTACTGA 1 55 1 GGAATTTAAG 0.976086 -67 AAGAGCGAACTGTCAAAGGTTCAGTAGTGCCTTTAAC 1 75 0 TGAAGGTTAG 0.986109 -47 CCATTTTACAGGTAGGGGTGATGGAAGAAAC 2 5 0 GGGGGTGAAG 0.968231 -34 CACCCCTACCTGTAAAATGGGCTCTAG 2 22 1 TGAATGGTAG 0.947361 -17 AGAAGGCTGGGGAAAAGGGTAGCGAAGATGTCATAAT 3 62 0 GGAGGGTAAG 0.992392 -174 TTAACCCATTGGGTGAAGGGAAGTTAGGTTGGAAAAC 3 152 0 GGAAGGGTAG 0.996427 -84 TCACCCAATGGGTTAAAGTGTGAGAAGTCTGAAAAAA 3 173 1 GGAAGTGAAG 0.996267 -63 ** ***** *** Masking position 16 Map Score: 10.4886 Number of sites scoring better than the average of aligned sites = 816 Number in coding regions = 728 Number in noncoding regions = 88 Number of orfs with sites within 600 bp upstream = 93 Fraction of orfs with sites within 600 bp upstream = 0.0149374 Motif number 2 AGTTAAACTTCTGCCAATTGTGCAAGTTCCGC 1 30 0 CTGCAATGTG 0.987851 -92 AAAGAGCGAACTGTCAAAGGTTCAGTAGTGCC 1 81 0 CTGCAAGGTT 0.988867 -41 TCTTTCAATGTTGGCAAAGGTTTT 1 108 1 TTGCAAGGTT 0.961629 -14 TCACCCCTACCTGTAAAATGGGCTCTAG 2 21 1 CTGAAATGGG 0.981134 -18 GCTACTACAGCAGAGAACTGGGGGTAAATCTT 3 12 1 CAGGAATGGG 0.973693 -224 TTGAGAAGGCTGGGGAAAAGGGTAGCGAAGAT 3 70 0 TGGGAAAGGG 0.859714 -166 TTCCCCAGCCTTCTCAATGGGGATTCATCATT 3 85 1 TTCCAAGGGG 0.973542 -151 TTTGTCCAGACTGTGACTGGGGTTTTCCAACC 3 131 1 CTGGACGGGG 0.984255 -105 AACTTCCCTTCACCCAATGGGTTAAAGTGTGA 3 164 1 CACCAAGGGT 0.946182 -72 TGTGAGAAGTCTGAAAAAAGTTCCATAATTTA 3 191 1 CTGAAAAGTT 0.868589 -45 *** *** **** Masking position 6 Map Score: 9.79235 Number of sites scoring better than the average of aligned sites = 2580 Number in coding regions = 2352 Number in noncoding regions = 228 Number of orfs with sites within 600 bp upstream = 240 Fraction of orfs with sites within 600 bp upstream = 0.038548 Motif number 3 AACAAAGATTACTAAAGATTTACCCCCAGT 3 28 0 ACTAAAGATT 0.979399 -208 CATAATTTTTAACAAAGATTACTAAAGATT 3 38 0 AACAAAGATT 0.953562 -198 GGAAAAGGGTAGCGAAGATGTCATAATTTT 3 59 0 AGCGAAGATG 0.945956 -177 CATTCGGTGAACCAATGATGAATCCCCATT 3 100 0 ACCAATGATG 0.980853 -136 CACAGTCTGGACAAAACATTCGGTGAACCA 3 116 0 ACAAAACATT 0.860837 -120 GTGGATTGGGACTAACGATGGCTAAATTAT 3 215 0 ACTAACGATG 0.97118 -21 ********** Masking position 5 Map Score: 1.9282 Number of sites scoring better than the average of aligned sites = 507 Number in coding regions = 455 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 61 Fraction of orfs with sites within 600 bp upstream = 0.00979762 Motif number 4 TTGCACAATTGGCAGAAGTTTAACTAACGG 1 37 1 GGCAGAAGTT 0.867264 -85 TTAACTAACGGGCGAATTTGTTAAAGGCAC 1 56 1 GGCGAATTTG 0.909385 -66 TTACAGGTAGGGGTGATGGAAGAAAC 2 7 0 GGGTGATGGA 0.955065 -32 GAGAAGGCTGGGGAAAAGGGTAGCGAAGAT 3 70 0 GGGAAAAGGG 0.97687 -166 TTAACCCATTGGGTGAAGGGAAGTTAGGTT 3 159 0 GGGTGAAGGG 0.992063 -77 TCACCCAATGGGTTAAAGTGTGAGAAGTCT 3 173 1 GGTTAAAGTG 0.956615 -63 GACTAACGATGGCTAAATTATGGAACTTTT 3 206 0 GGCTAAATTA 0.841208 -30 GGTGGATTGGGACTAACGAT 3 226 0 GGTGGATTGG 0.918073 -10 ********** Masking position 6 Map Score: 5.01004 Number of sites scoring better than the average of aligned sites = 3516 Number in coding regions = 3132 Number in noncoding regions = 384 Number of orfs with sites within 600 bp upstream = 378 Fraction of orfs with sites within 600 bp upstream = 0.0607131 Motif number 5 ********** No masking Map Score: 8.19556e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 8.19556e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 8.19556e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0