AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i307_mixed21_synecho_reg_100.orf -o307_synecho_100.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY40674 143 Synechocystis #2 RCY52862 204 Synechocystis Motif number 1 ATTCAAATTCAGAGAAACTTGACTTATATGA 1 29 1 AGAGAACTTG 0.988549 -115 TTAATTAAGGAAAGATGCTTGTCATTGAAAC 1 103 0 AAAGAGCTTG 0.972203 -41 AATGAATTCAAAATAAGCTGGTGACGGGATT 2 31 1 AAATAGCTGG 0.968584 -174 GCTCAGTGGTAGAGCAACTGATTTGTAATCA 2 78 0 AGAGCACTGA 0.947973 -127 ATTCTGTATCAGAGATGCTGGTGTAGCTCAG 2 103 0 AGAGAGCTGG 0.998063 -102 AGATTAACCCAGAGGGTCTGGCTAATTTTTG 2 140 1 AGAGGTCTGG 0.985165 -65 ***** ***** Masking position 3 Map Score: 6.64868 Number of sites scoring better than the average of aligned sites = 220 Number in coding regions = 189 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 2 ATGAAGTAAATAGGTTTTGGTCACCATATCCT 1 60 0 TAGGTTTGTC 0.959931 -84 CTATTTACTTCATCTATTATTCGTGTTTCAAT 1 79 1 CATCTTTATC 0.945617 -65 CCTTAATTAACAGGTATAGTTCCATACAAA 1 124 1 CAGGTTAGTC 0.99334 -20 CAGTCGGTCGCAGGTTCAAATCCCGTCACCAG 2 48 0 CAGGTCAATC 0.987889 -157 ATCAGAGATGCTGGTGTAGCTCAGTGGTAGAG 2 95 0 CTGGTTAGTC 0.987877 -110 CTGGGTTAATCTTCTGCTATTCTGTATCAGAG 2 120 0 CTTCTCTATC 0.885433 -85 ***** *** ** Masking position 5 Map Score: 1.98774 Number of sites scoring better than the average of aligned sites = 342 Number in coding regions = 298 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 3 GGAAAGATGCTTGTCATTGAAACACGAATA 1 96 0 TTGTCATTGA 0.966447 -48 ATTCATTAACCTATCATTGATCATCGT 2 8 0 CTATCATTGA 0.966448 -197 GGATTTGAACCTGCGACCGACTGATTACAA 2 57 1 CTGCGACCGA 0.979755 -148 ATCAGTTGCTCTACCACTGAGCTACACCAG 2 87 1 CTACCACTGA 0.985927 -118 TGGCTAATTTTTGTCCCCGAAAAACTTTTT 2 158 1 TTGTCCCCGA 0.969272 -47 ********** Masking position 2 Map Score: 1.65692 Number of sites scoring better than the average of aligned sites = 589 Number in coding regions = 532 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 62 Fraction of orfs with sites within 600 bp upstream = 0.00995824 Motif number 4 ATTCGTCCATAGAATTCAAATTCAGAGAAA 1 16 1 AGAATTCAAA 0.974963 -128 CAGGTATAGTTCCATACAAA 1 134 1 TCCATACAAA 0.955604 -10 GATAGGTTAATGAATTCAAAATAAGCTGGT 2 23 1 TGAATTCAAA 0.989938 -182 TGCGACCGACTGATTACAAATCAGTTGCTC 2 68 1 TGATTACAAA 0.974951 -137 ********** Masking position 5 Map Score: 1.48532 Number of sites scoring better than the average of aligned sites = 78 Number in coding regions = 67 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 5 GAATTCAAATTCAGAGAAACTTGACTTATA 1 27 1 TCAGAGAAAC 0.985978 -117 AAGATGCTTGTCATTGAAACACGAATAATA 1 93 0 TCATTGAAAC 0.950755 -51 AATTTTTGTCCCCGAAAAACTTTTTTAACG 2 163 1 CCCGAAAAAC 0.986997 -42 TTTTTAACGATCCGTAAAACCTAGTAAAAC 2 184 1 TCCGTAAAAC 0.990172 -21 TCCGTAAAACCTAGTAAAACC 2 194 1 CTAGTAAAAC 0.950752 -11 ********** Masking position 7 Map Score: 4.4027 Number of sites scoring better than the average of aligned sites = 157 Number in coding regions = 128 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 6 ********** No masking Map Score: -7.8627e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -7.8627e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -7.8627e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0