AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i316_mixed3_synecho_reg_300.orf -o316_synecho_300.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY43260 300 Synechocystis Motif number 1 CAATTTGGATAGTGGTGGGTGATCAACAGCA 1 26 0 AGGGTGGGTG 0.997964 -275 GTTTCCAAAAAGCAGTGGGACAATTTGGATA 1 46 0 AGAGTGGGAC 0.995497 -255 CTATGCGTGGATGAGTGGGACTGCCTGGGAC 1 227 1 ATAGTGGGAC 0.989912 -74 AGGCAAATAGATTGGTGAGTCCCAGGCAGTC 1 245 0 ATGGTGAGTC 0.983794 -56 CGATTGAATCAGAGGTCGGTGGTGAAAACTC 1 276 0 AGGGTCGGTG 0.992866 -25 ** ******** Masking position 6 Map Score: 6.30013 Number of sites scoring better than the average of aligned sites = 192 Number in coding regions = 180 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 ACAAAAGATTTGATCTGCTGTT 1 3 1 AAAAGATTTG 0.915183 -298 TACAAGGTGTAAAGAATTTGTTCCGTTTCC 1 71 0 AAAGAATTTG 0.875882 -230 ACCTTGTAATGCAAGCTTTTACAGACCTTA 1 93 1 GCAAGCTTTT 0.842624 -208 ACAGACCTTAATAAACTTTGTTTATCTCTC 1 113 1 ATAAACTTTG 0.934364 -188 TATCTCTCTAATAAGATTTTCTGGGGCCTA 1 135 1 ATAAGATTTT 0.915663 -166 AAAAAGGCGGACAAGATTTTCGCTATGGGC 1 194 0 ACAAGATTTT 0.924362 -107 ********** Masking position 7 Map Score: 3.88747 Number of sites scoring better than the average of aligned sites = 445 Number in coding regions = 357 Number in noncoding regions = 88 Number of orfs with sites within 600 bp upstream = 87 Fraction of orfs with sites within 600 bp upstream = 0.0139737 Motif number 3 AATTTGTTCCGTTTCCAAAAAGCAGTGGGA 1 57 0 GTTTCCAAAA 0.966354 -244 TGTAATGCAAGCTTTTACAGACCTTAATAA 1 97 1 GCTTTTACAG 0.944975 -204 TTCGCTATGGGCTTCCACAAACTACCACGT 1 176 0 GCTTCCACAA 0.994469 -125 ATTTGCCTGAGTTTTCACCACCGACCTCTG 1 268 1 GTTTTCACCA 0.977828 -33 ********** Masking position 4 Map Score: 0.671408 Number of sites scoring better than the average of aligned sites = 304 Number in coding regions = 288 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 4 GTGGGACAATTTGGATAGTGGTGGGTGATCA 1 32 0 TTGGATGTGG 0.976827 -269 AAACTACCACGTAAATTGGGGGTTAGGCCCC 1 157 0 GTAAATGGGG 0.979249 -144 AATTTACGTGGTAGTTTGTGGAAGCCCATAG 1 171 1 GTAGTTGTGG 0.952145 -130 GGACAAGATTTTCGCTATGGGCTTCCACAAA 1 185 0 TTCGCTTGGG 0.881658 -116 TGTACTATGCGTGGATGAGTGGGACTGCCTG 1 223 1 GTGGATAGTG 0.868557 -78 ACTCAGGCAAATAGATTGGTGAGTCCCAGGC 1 249 0 ATAGATGGTG 0.900428 -52 TGAATCAGAGGTCGGTGGTGAAAACTCAGGC 1 272 0 GTCGGTGTGA 0.838137 -29 CGACCTCTGATTCAATCGGGGT 1 289 1 TTCAATGGGG 0.972921 -12 ****** **** Masking position 6 Map Score: 1.4477 Number of sites scoring better than the average of aligned sites = 3763 Number in coding regions = 3390 Number in noncoding regions = 373 Number of orfs with sites within 600 bp upstream = 373 Fraction of orfs with sites within 600 bp upstream = 0.0599101 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0