AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i325_not_clear_synecho_reg_300.orf -o325_synecho_300.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY40191 189 Synechocystis #2 RCY31627 81 Synechocystis Motif number 1 ATTGTTCTTTCCCCCCGCACCCC 1 2 0 CCCCCGACCC 0.999121 -188 GGGAGTTTTCCCCCCCGGAGCCCCCATTGGAT 1 47 0 CCCCCGAGCC 0.999321 -143 GAGGGAAATCCGTCCCCAAGCCTGGGAGTTTT 1 70 0 CTCCCCAGCC 0.997038 -120 GGGGACGGATTTCCCTCTAGCCTTGGGTTTAG 1 85 1 TCCCTCAGCC 0.997866 -105 GCGCTGACATTGCCCCCCAGTCGGCAATAATG 1 136 1 TCCCCCAGTC 0.995341 -54 AGCTGTTTATTTCCATGGACCCTGACGGTCAA 2 17 1 TCCATGACCC 0.974234 -65 * ***** **** Masking position 9 Map Score: 13.0068 Number of sites scoring better than the average of aligned sites = 535 Number in coding regions = 476 Number in noncoding regions = 59 Number of orfs with sites within 600 bp upstream = 58 Fraction of orfs with sites within 600 bp upstream = 0.00931577 Motif number 2 GGGGTGCGGGGGGAAAGAACAATTTAA 1 8 1 GGGGGGAAAG 0.998535 -182 GGGGGCTCCGGGGGGGAAAACTCCCAGGCT 1 54 1 GGGGGGAAAA 0.998768 -136 ACCCAAGGCTAGAGGGAAATCCGTCCCCAA 1 83 0 AGAGGGAAAT 0.975069 -107 ATTGCCGACTGGGGGGCAATGTCAGCGCTC 1 134 0 GGGGGGCAAT 0.99727 -56 GTCAAGCAAGGGCAGGAAAAGTATCATGGA 2 44 1 GGCAGGAAAA 0.983041 -38 ********** Masking position 8 Map Score: 9.94981 Number of sites scoring better than the average of aligned sites = 594 Number in coding regions = 513 Number in noncoding regions = 81 Number of orfs with sites within 600 bp upstream = 76 Fraction of orfs with sites within 600 bp upstream = 0.0122069 Motif number 3 CCGGAGCCCCCATTGGATCTGCCAAAATTAAATT 1 31 0 CATTGAGCCA 0.967903 -159 GGAAAACTCCCAGGCTTGGGGACGGATTTCCCTC 1 68 1 CAGGCTGACG 0.974059 -122 TCCCTCTAGCCTTGGGTTTAGCCAGCAGTTTCTC 1 96 1 CTTGGTGCCA 0.988978 -94 CTGGCAAAGACAAGGTTAACGACAGATACATTAT 1 162 0 CAAGGTGACA 0.992554 -28 CGTCAGGGTCCATGGAAATAAACAGCTTTCAAC 2 10 0 CATGGAAACA 0.97324 -72 GGAAAAGTATCATGGATGATGACGCCCTAATTCT 2 58 1 CATGGTGACG 0.997256 -24 ***** * **** Masking position 13 Map Score: 2.48731 Number of sites scoring better than the average of aligned sites = 790 Number in coding regions = 734 Number in noncoding regions = 56 Number of orfs with sites within 600 bp upstream = 57 Fraction of orfs with sites within 600 bp upstream = 0.00915516 Motif number 4 TTTAATTTTGGCAGATCCAATGGGGGCTCCGGG 1 33 1 GCATCCAAGG 0.983531 -157 GGAAATCCGTCCCCAAGCCTGGGAGTTTTCCCC 1 66 0 CCAAGCCTGG 0.972624 -124 GAAACTGCTGGCTAAACCCAAGGCTAGAGGGAA 1 95 0 GCAACCCAGG 0.996945 -95 CCGACTGGGGGGCAATGTCAGCGCTCAAAAGAG 1 127 0 GGATGTCACG 0.936912 -63 GGGCCTGGCAAAGACAAGGTTAACGACAG 1 171 0 GGAAGACAGG 0.99177 -19 GGACCCTGACGGTCAAGCAAGGGCAGGAAAAGT 2 33 1 GGAAGCAAGG 0.995332 -49 ** ****** ** Masking position 5 Map Score: 3.14339 Number of sites scoring better than the average of aligned sites = 1408 Number in coding regions = 1289 Number in noncoding regions = 119 Number of orfs with sites within 600 bp upstream = 129 Fraction of orfs with sites within 600 bp upstream = 0.0207196 Motif number 5 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0