AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i008_Uracil_Utilization_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 uraA 85 uracil transport #2 upp 297 uracil phosphoribosyltransferase Motif number 1 CGACTCTTAAAGTCGGCTTTAATTATTTTT 1 16 0 AGTCGGCTTT 0.996751 -70 CGACTTTAAGAGTCGGCTTTTTTTTGAGTA 1 31 1 AGTCGGCTTT 0.996751 -55 GTCTCGCAAACGTTTGCTTTCCCTGTTAGA 2 63 0 CGTTTGCTTT 0.978239 -235 AACGTTTGCGAGACTGCTTTACACAACCTT 2 79 1 AGACTGCTTT 0.974064 -219 CCCTGGCACAAGTCTTCTTTCGCCGCGCGC 2 129 0 AGTCTTCTTT 0.991406 -169 CGGATGGAATAATCTTCTTTCATAACCATC 2 173 1 AATCTTCTTT 0.957834 -125 ATATTCTTTTCGTTGACTTTAGTCAAAATG 2 236 0 CGTTGACTTT 0.951352 -62 TCAAGGCGGCAATATTCTTTTCGTTGACTT 2 247 0 AATATTCTTT 0.746611 -51 AGGTATAATCCGTCGATTTTTTTT 2 284 1 CGTCGATTTT 0.893412 -14 ********** Masking position 8 Map Score: 15.5104 Number of sites scoring better than the average of aligned sites = 775 Number in coding regions = 700 Number in noncoding regions = 75 Number of orfs with sites within 600 bp upstream = 68 Fraction of orfs with sites within 600 bp upstream = 0.0109219 Motif number 2 CGCAAGTAACGCGTGGGGACCCAAGCA 2 8 0 GCGTGGGGAC 0.99663 -290 TTCGCCGCGCGCCTGGGGAAAAGACGTGCA 2 111 0 GCCTGGGGAA 0.99802 -187 TTCCCCAGGCGCGCGGCGAAAGAAGACTTG 2 121 1 GCGCGGCGAA 0.993725 -177 GAAGACTTGTGCCAGGGTAAAGGTTAGTTT 2 142 1 GCCAGGGTAA 0.986319 -156 ********** Masking position 9 Map Score: 4.52583 Number of sites scoring better than the average of aligned sites = 139 Number in coding regions = 90 Number in noncoding regions = 49 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 3 AAGCCGACTCTTAAAGTCGGCTTTAATTAT 1 20 0 TTAAAGTCGG 0.990264 -66 GTATTATGTGTTATAGGCGCTTTACTCAAA 1 53 0 TTATAGGCGC 0.962396 -33 TCCCCACGCGTTACTTGCGGTAGAAAAATA 2 19 1 TTACTTGCGG 0.936384 -279 GGTAGAAAAATAAAATTCGGCGCAATTCTA 2 37 1 TAAAATTCGG 0.941032 -261 TAAAGTTATTTTATATTCAGATGGTTATGA 2 192 0 TTATATTCAG 0.874744 -106 ACCTCCTTTCTTCAAGGCGGCAATATTCTT 2 258 0 TTCAAGGCGG 0.983188 -40 ********** Masking position 1 Map Score: 2.68234 Number of sites scoring better than the average of aligned sites = 833 Number in coding regions = 763 Number in noncoding regions = 70 Number of orfs with sites within 600 bp upstream = 81 Fraction of orfs with sites within 600 bp upstream = 0.01301 Motif number 4 TTTTTTTTGAGTAAAGCGCCTATAACACAT 1 48 1 GTAAAGCGCC 0.886884 -38 TTCCCTGTTAGAATTGCGCCGAATTTTATT 2 45 0 GAATTGCGCC 0.99123 -253 CTTTTTGCACGTCTTTTCCCCAGGCGCGCG 2 106 1 GTCTTTTCCC 0.947768 -192 GGCACAAGTCTTCTTTCGCCGCGCGCCTGG 2 125 0 TTCTTTCGCC 0.950644 -173 GGCGAAAGAAGACTTGTGCCAGGGTAAAGG 2 135 1 GACTTGTGCC 0.992918 -163 TCTTTTCGTTGACTTTAGTCAAAATGATAA 2 232 0 GACTTTAGTC 0.743707 -66 TCAACGAAAAGAATATTGCCGCCTTGAAGA 2 250 1 GAATATTGCC 0.96162 -48 ********** Masking position 10 Map Score: 5.00684 Number of sites scoring better than the average of aligned sites = 1942 Number in coding regions = 1835 Number in noncoding regions = 107 Number of orfs with sites within 600 bp upstream = 115 Fraction of orfs with sites within 600 bp upstream = 0.0184709 Motif number 5 ATTATCCTCTGTATTATGTGTTATAGGCGC 1 63 0 GTATTATGTG 0.955416 -23 AGTATTATCCTCTGTATTATG 1 75 0 GTATTATCCT 0.98289 -11 TTTTCGGATGGAATAATCTTCTTTCATAAC 2 169 1 GAATAATCTT 0.936298 -129 AAGAAAGGAGGTATAATCCGTCGATTTTTT 2 276 1 GTATAATCCG 0.988871 -22 ********** Masking position 6 Map Score: 0.723255 Number of sites scoring better than the average of aligned sites = 81 Number in coding regions = 59 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 6 ********** No masking Map Score: -4.09683e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.09683e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -4.09683e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0