AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i016_Pentose_Phosphate_Shunt_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 xylB 71 xylulokinase #2 xylA 300 D-xylose isomerase Motif number 1 CGGCTAACTGTGCAGTCCGTTGGC 1 5 1 TAACTGTGCA 0.973091 -67 TCGCTACCGATAACCGGGCCAACGGACTGC 1 22 0 TAACCGGGCC 0.983327 -50 ATCGGTAGCGATACCGGGCATTTTTTTAAG 1 41 1 ATACCGGGCA 0.990951 -31 TTTAGCAACTAAACAGGGGAAAACAATTAC 2 16 1 AAACAGGGGA 0.954981 -285 TGGAATGATGAAACTGGGTAATTCCTCGAA 2 142 0 AAACTGGGTA 0.979164 -159 TGAAATAACATAATTGAGCAACTGAAAGGG 2 221 1 TAATTGAGCA 0.907965 -80 TGATGTCGTAATATTGGGCACTCCCTTTCA 2 243 0 ATATTGGGCA 0.973063 -58 ********** Masking position 3 Map Score: 7.31118 Number of sites scoring better than the average of aligned sites = 1013 Number in coding regions = 895 Number in noncoding regions = 118 Number of orfs with sites within 600 bp upstream = 119 Fraction of orfs with sites within 600 bp upstream = 0.0191134 Motif number 2 CGGCTAACTGTGCAGTCCGTTGGCCCGGTTA 1 9 1 TGTGCATGTT 0.973552 -63 GTAGCGATACCGGGCATTTTTTTAAGGAACGAT 1 45 1 CGGGCATTTT 0.933543 -27 TTACTTTTGTTGCGCAATTGTACTTATTGCATT 2 103 1 TGCGCATTAC 0.919718 -198 ATGATGAAACTGGGTAATTCCTCGAAGAGAAAA 2 135 0 TGGGTATCTC 0.979232 -166 AATTCACAAGTGTGCGCTCGCTCGCAAAATAAA 2 173 0 TGTGCGTCTC 0.98543 -128 AGCGCACACTTGTGAATTATCTCAATAGCAGTG 2 188 1 TGTGAATCTC 0.985809 -113 TCAATAGCAGTGTGAAATAACATAATTGAGCAA 2 209 1 TGTGAATCAT 0.94129 -92 GTCGTAATATTGGGCACTCCCTTTCAGTTGCTC 2 236 0 TGGGCATCTT 0.994844 -65 ****** * *** Masking position 8 Map Score: 5.88148 Number of sites scoring better than the average of aligned sites = 585 Number in coding regions = 537 Number in noncoding regions = 48 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 3 CCGGGCATTTTTTTAAGGAACGATCGAT 1 54 1 TTTTAGACGA 0.969748 -18 CAATTTTTAGCAACTAAACAGGGGAA 2 4 1 TTTTTCACTA 0.939798 -297 AATTACAGATTTTTATCTTTCGATTACGATTTT 2 40 1 TTTTATTCGA 0.986198 -261 ACTTATTGCATTTTTCTCTTCGAGGAATTACCC 2 124 1 TTTTTCTCGA 0.988539 -177 CATCATTCCATTTTATTTTGCGAGCGAGCGCAC 2 162 1 TTTTATTCGA 0.986188 -139 AATTATGTTATTTCACACTGCTATTGAGATAAT 2 203 0 TTTCACTCTA 0.952068 -98 ***** ** *** Masking position 3 Map Score: 2.88679 Number of sites scoring better than the average of aligned sites = 157 Number in coding regions = 115 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 50 Fraction of orfs with sites within 600 bp upstream = 0.00803084 Motif number 4 ATGCCCGGTATCGCTACCGATAACCGGGCC 1 32 0 TCGCTACCGA 0.912348 -40 CAATTTTTAGCAACTAAACAGGGGAAA 2 8 1 TAGCAACTAA 0.976776 -293 AAGTACAATTGCGCAACAAAAGTAAGATCT 2 98 0 GCGCAACAAA 0.982779 -203 TAACATAATTGAGCAACTGAAAGGGAGTGC 2 226 1 GAGCAACTGA 0.99016 -75 ********** Masking position 6 Map Score: 0.968942 Number of sites scoring better than the average of aligned sites = 215 Number in coding regions = 200 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 5 GCATTTTTTTAAGGAACGATCGAT 1 58 1 AAGGAACGAT 0.981991 -14 AAAAATCGTAATCGAAAGATAAAAATCTGT 2 44 0 ATCGAAAGAT 0.935481 -257 TTGCGCAACAAAAGTAAGATCTCGGTCATA 2 90 0 AAAGTAAGAT 0.918497 -211 GCAAAATAAAATGGAATGATGAAACTGGGT 2 153 0 ATGGAATGAT 0.976289 -148 ********** Masking position 6 Map Score: 0.393837 Number of sites scoring better than the average of aligned sites = 68 Number in coding regions = 45 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 6 ********** No masking Map Score: 4.92707e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 4.92707e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 4.92707e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0