AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i031_2_7_1_29_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 b1200 188 putative dihydroxyacetone kinase (EC 2.7.1.2) Motif number 1 ATGTTCCATATTGAAACTTTTACGTGTATT 1 53 0 TTGAAACTTT 0.935338 -136 AAGTTTCAATATGGAACATTCATTAAAGCA 1 64 1 ATGGAACATT 0.989068 -125 ATGTTTCATAGTGAAACATATGCTTTAATG 1 84 0 GTGAAACATA 0.992355 -105 ATGTTTCACTATGAAACATAATTTGGGCTA 1 95 1 ATGAAACATA 0.988224 -94 TCGCCGTGTCGTTGAACATCATCC 1 175 1 GTTGAACATC 0.957322 -14 ********** Masking position 5 Map Score: 5.42622 Number of sites scoring better than the average of aligned sites = 155 Number in coding regions = 125 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 2 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0