AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i031_2_7_1_29_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 b1200 188 putative dihydroxyacetone kinase (EC 2.7.1.2) Motif number 1 AATACACGTAAAAGTTTCAATATGGAACAT 1 53 1 AAAGTTTCAA 0.945233 -136 TGCTTTAATGAATGTTCCATATTGAAACTT 1 64 0 AATGTTCCAT 0.990816 -125 CATTAAAGCATATGTTTCACTATGAAACAT 1 84 1 TATGTTTCAC 0.993585 -105 TAGCCCAAATTATGTTTCATAGTGAAACAT 1 95 0 TATGTTTCAT 0.990112 -94 GGATGATGTTCAACGACACGGCGA 1 175 0 GATGTTCAAC 0.963894 -14 ********** Masking position 5 Map Score: 5.42622 Number of sites scoring better than the average of aligned sites = 155 Number in coding regions = 125 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 2 ACGTAAAAGTTTCAATATGGAACATTCATT 1 58 1 TTCAATATGG 0.990721 -131 AAGCATATGTTTCACTATGAAACATAATTT 1 89 1 TTCACTATGA 0.99072 -100 CCTTGCCTGATGCACAATGGATTCATCGGC 1 136 1 TGCACAATGG 0.992848 -53 ********** Masking position 4 Map Score: 1.88524 Number of sites scoring better than the average of aligned sites = 42 Number in coding regions = 40 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 6.63809e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0