AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i034_Pyruvate_Synthase_2_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ydbK 300 putative oxidoreductase, Fe-S subunit #2 cysJ 300 sulfite reductase (NADPH), flavoprotein beta subunit Motif number 1 AAAAAAATAGCCATAAAAAAGTAAAAATGCG 1 130 0 CCAAAAAAAG 0.881478 -171 AAACAGAGGGCAAAAAAATAGCCATAAAAAA 1 141 0 CAAAAAATAG 0.967229 -160 ATGAATGTTTTGATCAAACAGAGGGCAAAAA 1 156 0 TGACAAACAG 0.941 -145 GACACAAAAGCGAAAATGCAGAAGAAAGCCA 1 202 1 CGAAATGCAG 0.883129 -99 CGATAAAACCGCCGTAGAGTA 2 1 1 CGAAAAACCG 0.990475 -300 TTAGATAATGCGAAAAAACAGCCTTTCCGGT 2 31 0 CGAAAAACAG 0.994716 -270 CGATTTTGCGCAACAAAGTCGTTTTAGATAA 2 54 0 CAAAAAGTCG 0.851093 -247 TAGTCTTTAACAACAAAATAGATTAACCAAC 2 130 0 CAAAAAATAG 0.967227 -171 TAAAGACTATTGCTAAAACAGGTTAGTCGAT 2 152 1 TGCAAAACAG 0.935074 -149 CGATAACTAATAACCAAATCGACTAACCTGT 2 169 0 TAACAAATCG 0.582983 -132 CTGTCAGCGCCCATAAAACAGAAGAGAAGGT 2 241 0 CCAAAAACAG 0.985207 -60 GCTGACAGGGCGCAGAAACAGCTTTGCTTAC 2 264 1 CGCGAAACAG 0.931534 -37 *** ******* Masking position 6 Map Score: 14.8547 Number of sites scoring better than the average of aligned sites = 1459 Number in coding regions = 1317 Number in noncoding regions = 142 Number of orfs with sites within 600 bp upstream = 149 Fraction of orfs with sites within 600 bp upstream = 0.0239319 Motif number 2 TAGGCAGCACAGAGGGCGGCGTCGAGAGCT 1 84 1 AGAGGGCGGC 0.975284 -217 GGGGCAACGCGCAGGACAGCTCTCGACGCC 1 101 0 GCAGGACAGC 0.970244 -200 AAGTAAAAATGCGGGGCAACGCGCAGGACA 1 113 0 GCGGGGCAAC 0.992072 -188 TTGATCAAACAGAGGGCAAAAAAATAGCCA 1 148 0 AGAGGGCAAA 0.959418 -153 ACGCTGATGTGGGGGACACAAAAGCGAAAA 1 188 1 GGGGGACACA 0.968565 -113 TTGCGCAAATGAGGGGCGCACGAAATTGCT 1 267 0 GAGGGGCGCA 0.95127 -34 TGGATTAAAGACGGGATAGCGATAACTAAT 2 189 0 ACGGGATAGC 0.830948 -112 GGTAAGGTTAACGGGGCAAACGGTGTGGAT 2 214 0 ACGGGGCAAA 0.98694 -87 ATGGGCGCTGACAGGGCGCAGAAACAGCTT 2 258 1 ACAGGGCGCA 0.980348 -43 ********** Masking position 5 Map Score: 9.87532 Number of sites scoring better than the average of aligned sites = 1610 Number in coding regions = 1452 Number in noncoding regions = 158 Number of orfs with sites within 600 bp upstream = 157 Fraction of orfs with sites within 600 bp upstream = 0.0252168 Motif number 3 ACACCCTACCCAAAACGCTGCTCGCATCTT 1 10 1 CCAAAAGCTG 0.969155 -291 AGATCAGAGGAAGAAAAGATGCGAGCAGCGT 1 25 0 AAGAAAGATG 0.824285 -276 CATAAAAAAGTAAAAATGCGGGGCAACGCGC 1 119 0 TAAAAAGCGG 0.902095 -182 ATGTGGGGGACACAAAAGCGAAAATGCAGAA 1 194 1 CACAAAGCGA 0.852551 -107 GAGGGGCGCACGAAATTGCTGCGCGCCCAGT 1 256 0 CGAAATGCTG 0.963291 -45 CCTTACATTGCGCAAATGAGGGGCGCACGAA 1 273 0 CGCAAAGAGG 0.919247 -28 CGTAGAGTACCGGAAAGGCTGTTTTTTCGCA 2 23 1 CGGAAAGCTG 0.990043 -278 CTTTGTTGCGCAAAATCGCTGATTTATCTTA 2 67 1 CAAAATGCTG 0.964183 -234 ATGTTCCAGTAAGCAAAGCTGTTTCTGCGCC 2 272 0 AAGCAAGCTG 0.842735 -29 ****** **** Masking position 5 Map Score: 4.77663 Number of sites scoring better than the average of aligned sites = 2656 Number in coding regions = 2490 Number in noncoding regions = 166 Number of orfs with sites within 600 bp upstream = 173 Fraction of orfs with sites within 600 bp upstream = 0.0277867 Motif number 4 GAAGAAAAGATGCGAGCAGCGTTTTGGGTA 1 17 0 TGCGAGCAGC 0.984867 -284 AGAGCTGTCCTGCGCGTTGCCCCGCATTTT 1 108 1 TGCGCGTTGC 0.972284 -193 ATTACTACTGGGCGCGCAGCAATTTCGTGC 1 250 1 GGCGCGCAGC 0.984369 -51 GCGCAAATGAGGGGCGCACGAAATTGCTGC 1 265 0 GGGGCGCACG 0.9398 -36 TTCTGTTTTATGGGCGCTGACAGGGCGCAG 2 249 1 TGGGCGCTGA 0.984647 -52 GGGCGCTGACAGGGCGCAGAAACAGCTTTG 2 260 1 AGGGCGCAGA 0.986059 -41 ********** Masking position 6 Map Score: 6.84045 Number of sites scoring better than the average of aligned sites = 1253 Number in coding regions = 1196 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 52 Fraction of orfs with sites within 600 bp upstream = 0.00835207 Motif number 5 TATGGCGGTGTCGTTTGGCTTGAAGATCAG 1 49 0 TCGTTTGGCT 0.968746 -252 ATCAAAACATTCATTACGCTGATGTGGGGG 1 173 1 TCATTACGCT 0.962994 -128 ATTTAGCCAATCATTAAGATAAATCAGCGA 2 82 0 TCATTAAGAT 0.865539 -219 TTGGCTAAATTCATTTGTTTTTCATTAGGT 2 102 1 TCATTTGTTT 0.842719 -199 CATTTGTTTTTCATTAGGTTGGTTAATCTA 2 113 1 TCATTAGGTT 0.984761 -188 GCGTCGTTATGTTCCAGTAAGCA 2 288 0 TCGTTATGTT 0.930959 -13 ********** Masking position 5 Map Score: 2.2668 Number of sites scoring better than the average of aligned sites = 210 Number in coding regions = 174 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 6 ATTATTTATGGCGGTGTCGTTTGGCTTGAA 1 55 0 GCGGTGTCGT 0.993963 -246 AGCACAGAGGGCGGCGTCGAGAGCTGTCCT 1 89 1 GCGGCGTCGA 0.987618 -212 GCGCAATGTAAGGGTGTCAT 1 291 1 AGGGTGTCAT 0.933361 -10 AACGGGGCAAACGGTGTGGATTAAAGACGG 2 205 0 ACGGTGTGGA 0.982282 -96 ********** Masking position 7 Map Score: 0.839887 Number of sites scoring better than the average of aligned sites = 354 Number in coding regions = 346 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 7 ********** No masking Map Score: 1.30983e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.30983e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 1.30983e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0