AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i055_Arginine_Metabolism_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 argF 300 ornithine carbamoyltransferase 2, chain F #2 yfcC 168 putative S-transferase #3 argI 161 ornithine carbamoyltransferase 1 Motif number 1 GTAATGAAGTAAGGCAGCAAGCCTCGCCAT 1 17 1 AAGGCAGCAA 0.909975 -284 CGCCATTTTAGAAGCATAATCCTTAAAATC 1 53 1 GAAGCATAAT 0.841521 -248 ATAATCCTTAAAATCATAAAGAAGGCCAAT 1 68 1 AAATCATAAA 0.882464 -233 CAACCAGGTCGAGTCAGAAATGAGAATGAT 1 96 0 GAGTCAGAAA 0.973838 -205 ATTCTCTGCAGAAGCAGAAAGACATTGGAT 1 135 0 GAAGCAGAAA 0.992579 -166 CAGAGAATCGGAGGCAGATACGATTATTTT 1 157 1 GAGGCAGATA 0.930552 -144 GCGGATATCTGAACCGGAAATAATCACTAT 2 38 1 GAACCGGAAA 0.960421 -131 AGAGAATAAAAAACCGGAAATAGTGATTAT 2 57 0 AAACCGGAAA 0.925098 -112 TTAAGCAAGATAATCAGAAAGGATTAATGC 2 93 0 TAATCAGAAA 0.889962 -76 TTGCAAGTCTAAAGCATAAATCTTTGTCAC 3 79 0 AAAGCATAAA 0.950514 -83 ********** Masking position 2 Map Score: 11.426 Number of sites scoring better than the average of aligned sites = 1042 Number in coding regions = 944 Number in noncoding regions = 98 Number of orfs with sites within 600 bp upstream = 118 Fraction of orfs with sites within 600 bp upstream = 0.0189528 Motif number 2 ATTCTTTCTTACAAAGGTGGAGGCAAACCCG 1 197 0 ACAAAGGGGA 0.990938 -104 AAATGGGGTTGCAAATGAATAATTACACATA 1 232 1 GCAAATGATA 0.96246 -69 AAGGATTAATGCAAATTAAGAGAATAAAAAA 2 74 0 GCAAATTAGA 0.96246 -95 TGGTAAGTATGCAAAGTGGGATGGCGCAATT 2 139 0 GCAAAGTGGA 0.990938 -30 AAAACAAAGTGGTAAGTATGCAAA 2 155 0 ACAAAGTGTA 0.96246 -14 AATCTTTGTCACAAAGGTGGAGGCAATGTCA 3 60 0 ACAAAGGGGA 0.990938 -102 CTTTAGACTTGCAAATGAATAATCATCCATA 3 95 1 GCAAATGATA 0.96246 -67 ******* *** Masking position 5 Map Score: 9.89181 Number of sites scoring better than the average of aligned sites = 363 Number in coding regions = 309 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 74 Fraction of orfs with sites within 600 bp upstream = 0.0118856 Motif number 3 CAAAGGTGGAGGCAAACCCGTCCGTGTGTGAA 1 185 0 GGCAACCGTC 0.995558 -116 ATCCTCGCATGGCGAACGCCACTTATTGAATT 1 276 0 GGCAACCCAC 0.996419 -25 GGCTCATTCCTCTTAATGTCCT 3 1 1 GGCCATCCTC 0.993717 -161 TACTCTTATTGTCACACACCACTGACATTGCC 3 38 1 GTCCACCCAC 0.991328 -124 TCCCTCCTGTGGCTAACGCCTCAATGAATTAA 3 137 0 GGCAACCCTC 0.998729 -25 *** *** **** Masking position 6 Map Score: 7.77749 Number of sites scoring better than the average of aligned sites = 77 Number in coding regions = 71 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 4 AATGAAGTAAGGCAGCAAGCCTCGCCATGT 1 19 1 GGCAGCAAGC 0.8967 -282 AATCCTTAAAATCATAAAGAAGGCCAATCA 1 70 1 ATCATAAAGA 0.884939 -231 ACCAGGTCGAGTCAGAAATGAGAATGATTG 1 94 0 GTCAGAAATG 0.929349 -207 TCTCTGCAGAAGCAGAAAGACATTGGATCG 1 133 0 AGCAGAAAGA 0.980501 -168 CTCCACCTTTGTAAGAAAGAATTGTGAAAT 1 206 1 GTAAGAAAGA 0.742142 -95 AGATATCCGCAGCGCAAAGCTGCGGATGAT 2 18 0 AGCGCAAAGC 0.903872 -151 GGATATCTGAACCGGAAATAATCACTATTT 2 40 1 ACCGGAAATA 0.858115 -129 AGAATAAAAAACCGGAAATAGTGATTATTT 2 55 0 ACCGGAAATA 0.858115 -114 AAGCAAGATAATCAGAAAGGATTAATGCAA 2 91 0 ATCAGAAAGG 0.974544 -78 ATAAATCTTTGTCACAAAGGTGGAGGCAAT 3 64 0 GTCACAAAGG 0.916004 -98 GCAAGTCTAAAGCATAAATCTTTGTCACAA 3 77 0 AGCATAAATC 0.780981 -85 ********** Masking position 7 Map Score: 7.2247 Number of sites scoring better than the average of aligned sites = 2573 Number in coding regions = 2352 Number in noncoding regions = 221 Number of orfs with sites within 600 bp upstream = 242 Fraction of orfs with sites within 600 bp upstream = 0.0388693 Motif number 5 TCTACAACCAGGTCGAGTCAGAAATGAGAA 1 100 0 GGTCGAGTCA 0.954458 -201 TTCTTACAAAGGTGGAGGCAAACCCGTCCG 1 193 0 GGTGGAGGCA 0.996005 -108 AATCAGAAAGGATTAATGCAAATTAAGAGA 2 82 0 GATTAATGCA 0.884766 -87 TGGCGCAATTCATTGATGCAGCGCAGTTAA 2 119 0 CATTGATGCA 0.962881 -50 TTGTCACAAAGGTGGAGGCAATGTCAGTGG 3 56 0 GGTGGAGGCA 0.996005 -106 AATTTTAATTCATTGAGGCGTTAGCCACAG 3 133 1 CATTGAGGCG 0.965601 -29 ********** Masking position 6 Map Score: 4.13735 Number of sites scoring better than the average of aligned sites = 463 Number in coding regions = 425 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 49 Fraction of orfs with sites within 600 bp upstream = 0.00787022 Motif number 6 TCACTTTATATGTGTAATTATTCATTTGCAACCC 1 237 0 TGGTTATTCA 0.653219 -64 ACATATAAAGTGAATTTTAATTCAATAAGTGGCG 1 258 1 TGATTATTCA 0.514681 -43 TCAATTTATATGGATGATTATTCATTTGCAAGTC 3 100 0 TGATTATTCA 0.514681 -62 CCATATAAATTGAATTTTAATTCATTGAGGCGTT 3 121 1 TGATTATTCA 0.514681 -41 ** ** * ***** Masking position 8 Map Score: 3.39021 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 5 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 7 TCTCGTCATCATCCGCAGCTTTGCGCTGC 2 10 1 CATCCGCAGC 0.994416 -159 CCGGTTCAGATATCCGCAGCGCAAAGCTGC 2 25 0 TATCCGCAGC 0.996816 -144 ACAATAAGAGTATCGGCAGGACATTAAGAG 3 20 0 TATCGGCAGG 0.991549 -142 ATTGAGGCGTTAGCCACAGGAGGGATCT 3 144 1 TAGCCACAGG 0.978933 -18 ********** Masking position 8 Map Score: 3.20192 Number of sites scoring better than the average of aligned sites = 140 Number in coding regions = 133 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 8 CAGCAAGCCTCGCCATGTTCTCCGCCATTT 1 31 1 CGCCATGTTC 0.979843 -270 CCATGTTCTCCGCCATTTTAGAAGCATAAT 1 43 1 CGCCATTTTA 0.985913 -258 TCATTTGCAACCCCATTTCACAATTCTTTC 1 220 0 CCCCATTTCA 0.968477 -81 AAGTGGCGTTCGCCATGCGAGGATAAA 1 284 1 CGCCATGCGA 0.989499 -17 CAATGAATTGCGCCATCCCACTTTGCATAC 2 134 1 CGCCATCCCA 0.989869 -35 ********** Masking position 5 Map Score: 3.06831 Number of sites scoring better than the average of aligned sites = 315 Number in coding regions = 285 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 9 CGAGTCAGAAATGAGAATGATTGGCCTTCT 1 87 0 ATGAGAATGA 0.971932 -214 CCGTCCGTGTGTGAAAATAATCGTATCTGC 1 170 0 GTGAAAATAA 0.942541 -131 CTCCACCTTTGTAAGAAAGAATTGTGAAAT 1 206 1 GTAAGAAAGA 0.894704 -95 AATGCAAATTAAGAGAATAAAAAACCGGAA 2 68 0 AAGAGAATAA 0.84455 -101 TCAGTGGTGTGTGACAATAAGAGTATCGGC 3 33 0 GTGACAATAA 0.978138 -129 CTCCACCTTTGTGACAAAGATTTATGCTTT 3 69 1 GTGACAAAGA 0.974165 -93 ********** Masking position 6 Map Score: 2.17812 Number of sites scoring better than the average of aligned sites = 366 Number in coding regions = 294 Number in noncoding regions = 72 Number of orfs with sites within 600 bp upstream = 83 Fraction of orfs with sites within 600 bp upstream = 0.0133312 Motif number 10 ********** No masking Map Score: -1.31207e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 11 ********** No masking Map Score: -1.31207e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 12 ********** No masking Map Score: -1.31207e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0