AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i064_Histidine_Biosynthesis_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 hisL 255 his operon leader peptide #2 hisG 145 ATP phosphoribosyltransferase Motif number 1 TCTTTCAGGCGATGTGTGCTG 2 2 1 CTTTCAGGCG 0.989216 -144 ACATTCAGATCTTCCAGTGGTGCATGAACG 2 36 1 CTTCCAGTGG 0.994715 -110 GGAAGGTGATCTTCCGGGGGCTTTCTCATG 2 66 0 CTTCCGGGGG 0.972951 -80 GGAAGATCACCTTCCGGGGGCTTTTTTATT 2 81 1 CTTCCGGGGG 0.972951 -65 ********** Masking position 3 Map Score: 9.14103 Number of sites scoring better than the average of aligned sites = 65 Number in coding regions = 59 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 2 TATTTTATGGCAATGGATTTGTTTAATGAA 1 155 0 CAATGGATTT 0.92469 -101 CGTTAGAAAGCAAGGGCTTTTTTATATATT 1 181 0 CAAGGGCTTT 0.995191 -75 TAAACATTCACAGAGACTTTT 1 245 1 CAGAGACTTT 0.965131 -11 GGTGATCTTCCGGGGGCTTTCTCATGCGTT 2 62 0 CGGGGGCTTT 0.998385 -84 GATCACCTTCCGGGGGCTTTTTTATTGCGC 2 85 1 CGGGGGCTTT 0.998385 -61 ********** Masking position 8 Map Score: 8.37114 Number of sites scoring better than the average of aligned sites = 260 Number in coding regions = 232 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 3 GGTGCCATCAGCTAAGAGGACAGTCCTCTTA 1 103 1 GCTAGAGGAC 0.993181 -153 AAAGGAGGGGGCTAAGAGGACTGTCCTCTTA 1 115 0 GCTAGAGGAC 0.993181 -141 ATGAATGAGCGGGGAAAGGAGGGGGCTAAGA 1 129 0 GGGAAAGGAG 0.983814 -127 AAGTGGTTTAGGTTAAAAGACATCAGTTGAA 1 214 1 GGTAAAAGAC 0.988664 -42 GGTTCAGACAGGTTTAAAGAGGAATAACAAA 2 125 1 GGTTAAAGAG 0.947918 -21 *** ******* Masking position 7 Map Score: 3.13497 Number of sites scoring better than the average of aligned sites = 51 Number in coding regions = 40 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 4 TAATAAATAGTTAATTAACGCTCATCATTG 1 15 0 TTAATTAACG 0.963129 -241 TACAAACTAATTAATAAATAGTTAATTAAC 1 26 0 TTAATAAATA 0.900728 -230 ATGGATTTGTTTAATGAATGAGCGGGGAAA 1 143 0 TTAATGAATG 0.969346 -113 AGACATCAGTTGAATAAACATTCACAGAGA 1 231 1 TGAATAAACA 0.95635 -25 CTTCCAGTGGTGCATGAACGCATGAGAAAG 2 46 1 TGCATGAACG 0.971947 -100 ********** Masking position 5 Map Score: 1.21866 Number of sites scoring better than the average of aligned sites = 265 Number in coding regions = 221 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 60 Fraction of orfs with sites within 600 bp upstream = 0.00963701 Motif number 5 ********** No masking Map Score: -8.2833e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -8.2833e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -8.2833e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0