AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i068_Proline_Biosynthesis_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 proB 287 gamma-glutamate kinase Motif number 1 AACGGGACTCTCCCGCTGAATATTCGCGCG 1 33 0 TCCCGCTGAA 0.918732 -255 AGCGGGAGAGTCCCGTTGAAAACAGGAAAG 1 46 1 TCCCGTTGAA 0.991009 -242 GGCTTGCTGATCCCGCGCAACAAAACGCCA 1 177 1 TCCCGCGCAA 0.93305 -111 CCGACGACAGTCCTGCTAAAACGTTCGTTT 1 232 1 TCCTGCTAAA 0.986552 -56 ********** Masking position 9 Map Score: 6.89324 Number of sites scoring better than the average of aligned sites = 74 Number in coding regions = 62 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 2 CGTTAATTAAAATCAGGAATGAAA 1 5 0 AATCAGGAAT 0.977178 -283 GTCCCGTTGAAAACAGGAAAGTTTTTAACC 1 55 1 AAACAGGAAA 0.963603 -233 GAATATTATTAATCTGTAATATATCTTTAA 1 93 0 AATCTGTAAT 0.978152 -195 ATATTCTTAAAATGTGGTAATTTATTAAAT 1 117 1 AATGTGGTAA 0.901339 -171 TAATTTATTAAATCTGTAATAAAAGCGTAA 1 134 1 AATCTGTAAT 0.978152 -154 ATCTGTAATAAAAGCGTAAACAACTGCCGC 1 145 1 AAAGCGTAAA 0.881009 -143 ********** Masking position 2 Map Score: 5.00377 Number of sites scoring better than the average of aligned sites = 498 Number in coding regions = 419 Number in noncoding regions = 79 Number of orfs with sites within 600 bp upstream = 91 Fraction of orfs with sites within 600 bp upstream = 0.0146161 Motif number 3 TTTCATTCCTGATTTTAATTAA 1 3 1 TCATTCCTGA 0.96402 -285 TTTCAACGGGACTCTCCCGCTGAATATTCG 1 37 0 ACTCTCCCGC 0.990225 -251 CAGGTTAAAAACTTTCCTGTTTTCAACGGG 1 57 0 ACTTTCCTGT 0.986049 -231 GCAACCGACGACAGTCCTGCTAAAACGTTC 1 228 1 ACAGTCCTGC 0.975718 -60 ********** Masking position 5 Map Score: 1.5724 Number of sites scoring better than the average of aligned sites = 210 Number in coding regions = 191 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 4 TAACCTGAGATTGTTAAAGATATATTACAG 1 80 1 TTGTTAAAGA 0.968713 -208 TGTTAAAGATATATTACAGATTAATAATAT 1 91 1 ATATTACAGA 0.98426 -197 GTTTACGCTTTTATTACAGATTTAATAAAT 1 136 0 TTATTACAGA 0.990763 -152 ********** Masking position 6 Map Score: 1.29766 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 16 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 5 ********** No masking Map Score: 2.93755e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.93755e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.93755e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0