AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i071_Tryptophan_Biosynthesis_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 trpE 91 anthranilate synthase component I #2 trpL 137 trp operon leader peptide #3 pabB 73 p-aminobenzoate synthetase, component I #4 pabA 31 p-aminobenzoate synthetase, component II #5 yhfG 104 orf, hypothetical protein Motif number 1 TCAGATACCCAGCCCGCCTAATGAGCGGGC 1 43 1 AGCCCGCCTA 0.964962 -49 TTCAAAAAAAAGCCCGCTCATTAGGCGGGC 1 54 0 AGCCCGCTCA 0.981153 -38 ACCGTTATGATGTCGGCGCAAAAAACATTA 2 30 0 TGTCGGCGCA 0.99302 -108 CCTGCTAAATTGTTGGCGCTAATTATTTCA 3 19 1 TGTTGGCGCT 0.902965 -55 ATTTCATGCTACCCGGCACATAGCCAGTAG 3 43 1 ACCCGGCACA 0.966541 -31 CGGGCAAGATTGCCCGCGCGAGAAATCA 5 9 0 TGCCCGCGCG 0.968278 -96 CGGGCAATCTTGCCCGCGCTTCTGCTCTCC 5 23 1 TGCCCGCGCT 0.801362 -82 GCTTCTGCTCTCCCGGCGTAACCCGGATTT 5 40 1 TCCCGGCGTA 0.985619 -65 ********** Masking position 6 Map Score: 13.309 Number of sites scoring better than the average of aligned sites = 1672 Number in coding regions = 1594 Number in noncoding regions = 78 Number of orfs with sites within 600 bp upstream = 77 Fraction of orfs with sites within 600 bp upstream = 0.0123675 Motif number 2 GCAAAAAACATTATCCAGAACGGGAGTGCGC 2 12 0 TTATCCAGAC 0.980667 -126 TTTCAGAATATTTGCCAGAACCGTTATGATG 2 48 0 TTTGCCAGAC 0.995062 -90 ATCGAACTAGTTAACTAGTACGCAAGTTCAC 2 99 1 TTAACTAGAC 0.932602 -39 GCGCCAACAATTTAGCAGGAGTTAACA 3 7 0 TTTAGCAGAG 0.953507 -67 TACCCGGCACATAGCCAGTAGAGTCAGGACT 3 52 1 ATAGCCAGAG 0.980283 -22 AACGTGTCCATTTGCCACAAGTATAAGCGGC 5 70 0 TTTGCCACAG 0.978807 -35 ******** ** Masking position 7 Map Score: 3.32841 Number of sites scoring better than the average of aligned sites = 912 Number in coding regions = 864 Number in noncoding regions = 48 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 3 AACGGGCAGTGTATTCACCATGC 1 4 1 GGGCAGTGTA 0.983579 -88 CTCATTAGGCGGGCTGGGTATCTGATTGCT 1 38 0 GGGCTGGGTA 0.981616 -54 TTATCCAGAACGGGAGTGCGCC 2 3 0 CGGGAGTGCG 0.97172 -135 TACTGGCTATGTGCCGGGTAGCATGAAATA 3 42 0 GTGCCGGGTA 0.957504 -32 TGATTTCTCGCGCGGGCAATCTTGCCCG 5 9 1 CGCGCGGGCA 0.922543 -96 CGGGTTACGCCGGGAGAGCAGAAGCGCGGG 5 35 0 CGGGAGAGCA 0.981618 -70 ********** Masking position 6 Map Score: 3.05571 Number of sites scoring better than the average of aligned sites = 1079 Number in coding regions = 986 Number in noncoding regions = 93 Number of orfs with sites within 600 bp upstream = 83 Fraction of orfs with sites within 600 bp upstream = 0.0133312 Motif number 4 TAACGGTTCTGGCAAATATTCTGAAATGAGC 2 53 1 GGCAAATTTC 0.977142 -85 TTAACTAGTACGCAAGTTCACGTAAAAAGGG 2 109 1 CGCAAGTCAC 0.955953 -29 CATGCTACCCGGCACATAGCCAGTAGAGTCA 3 47 1 GGCACATGCC 0.954066 -27 CAGAAGCGCGGGCAAGATTGCCCGCGCGAGA 5 16 0 GGCAAGATGC 0.959937 -89 AAGTATAAGCGGCAAATCCGGGTTACGCCGG 5 52 0 GGCAAATCGG 0.976649 -53 TTATACTTGTGGCAAATGGACACGTTCAGGG 5 75 1 GGCAAATGAC 0.98115 -30 ******* *** Masking position 4 Map Score: 0.865886 Number of sites scoring better than the average of aligned sites = 808 Number in coding regions = 746 Number in noncoding regions = 62 Number of orfs with sites within 600 bp upstream = 70 Fraction of orfs with sites within 600 bp upstream = 0.0112432 Motif number 5 ********** No masking Map Score: 3.15071e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.15071e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.15071e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0