AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i085_PTS_mannitol_specific_Transport_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 sgaT 291 orf, hypothetical protein Motif number 1 TCATGATAGTTCAATTCGAATCAATATGTGATT 1 17 1 TCAATTAACA 0.976401 -275 TCAGGATTAATCAAAACCAATCACATATTGATT 1 35 0 TCAAAAAACA 0.996816 -257 CTTTCCATACTCAAAATCAACAACAACTTCCCT 1 113 0 TCAAAAAAAA 0.979779 -179 AGTGGGATTCACACAACGAAACAATTATCCATT 1 186 0 ACACAAAACA 0.984629 -106 GCGGGTCGCGTCACATTTAATCATAAATAATCT 1 239 1 TCACATAACA 0.992851 -53 ACTCTAATTTTCAAAAGTAATCACAACAAGATT 1 267 0 TCAAAAAACA 0.996802 -25 ****** ** ** Masking position 9 Map Score: 9.00826 Number of sites scoring better than the average of aligned sites = 41 Number in coding regions = 26 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 2 CTTCATGATAGTTCAATTCGAATCAATATG 1 15 1 GTTCAATTCG 0.940815 -277 TGAATTACACATTCCATTAAATCTTTCCAT 1 138 0 ATTCCATTAA 0.970316 -154 GGAATGTGTAATTCAATTAACTAAATGAAT 1 153 1 ATTCAATTAA 0.986406 -139 ATCCATTTAAATTCATTTAGTTAATTGAAT 1 163 0 ATTCATTTAG 0.982033 -129 CGAAACAATTATCCATTTAAATTCATTTAG 1 173 0 ATCCATTTAA 0.958002 -119 ********** Masking position 7 Map Score: 3.69817 Number of sites scoring better than the average of aligned sites = 45 Number in coding regions = 24 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 3 CATTCCATTAAATCTTTCCATACTCAAAAT 1 129 0 AATCTTTCCA 0.991523 -163 TAATTGAATTACACATTCCATTAAATCTTT 1 142 0 ACACATTCCA 0.986227 -150 TGTGAATCCCACTCTATCCATGTGGAATTA 1 206 1 ACTCTATCCA 0.986227 -86 GCGACCCGCAAATAATTCCACATGGATAGA 1 218 0 AATAATTCCA 0.967145 -74 ********** Masking position 7 Map Score: 3.22819 Number of sites scoring better than the average of aligned sites = 85 Number in coding regions = 72 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 ATGTGATTGGTTTTGATTAATCCTGACACTA 1 42 1 TTTTGATAAT 0.984281 -250 AATGACCATTTTTTGACTTTTTGCCAGGGAA 1 88 1 TTTTGATTTT 0.964723 -204 TTGTTGTTGATTTTGAGTATGGAAAGATTTA 1 120 1 TTTTGATATG 0.981415 -172 ACAAGATTATTTATGATTAAATGTGACGCGA 1 244 0 TTATGATAAA 0.882911 -48 TTGTGATTACTTTTGAAAATTAGAGTGA 1 274 1 TTTTGAAATT 0.964695 -18 ****** **** Masking position 6 Map Score: 2.3167 Number of sites scoring better than the average of aligned sites = 77 Number in coding regions = 53 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 5 CCTGAAAAAATAGTGTCAGGATTAATCAAA 1 53 0 TAGTGTCAGG 0.984825 -239 CCTGACACTATTTTTTCAGGAAGGCAATGA 1 63 1 TTTTTTCAGG 0.986212 -229 TTTTTTGACTTTTTGCCAGGGAAGTTGTTG 1 96 1 TTTTGCCAGG 0.989355 -196 CATGTGGAATTATTTGCGGGTCGCGTCACA 1 224 1 TATTTGCGGG 0.972425 -68 ********** Masking position 4 Map Score: 1.67238 Number of sites scoring better than the average of aligned sites = 209 Number in coding regions = 164 Number in noncoding regions = 45 Number of orfs with sites within 600 bp upstream = 54 Fraction of orfs with sites within 600 bp upstream = 0.00867331 Motif number 6 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0