AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i097_Phosphate_Transport_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 pitB 291 low-affinity phosphate transport Motif number 1 ATTATTCTTCATAATCAGTACGGGGTTGCTA 1 20 0 ATAATCATAC 0.984374 -272 ATTATGAAGAATAATCAGTACGGGGATTAAT 1 36 1 ATAATCATAC 0.984374 -256 ATTAATCAAAATATTCAATATTTATATATTC 1 61 1 ATATTCATAT 0.683029 -231 ATTCCAATATTTATTCATTTCATATGTGAAT 1 88 1 TTATTCATTC 0.937486 -204 ACTGGTTAATATATTCACATATGAAATGAAT 1 100 0 ATATTCAATA 0.868625 -192 ACCTTTAGAAATAATCAAAACACAGGTATTC 1 132 0 ATAATCAAAC 0.985124 -160 CAATAAGCATTCATTCAAAACCTTTAGAAAT 1 151 0 TCATTCAAAC 0.929358 -141 GTCCGTTCGTAAATTCAAAATGGCGTAATCT 1 266 1 AAATTCAAAT 0.860144 -26 ******* *** Masking position 7 Map Score: 9.13836 Number of sites scoring better than the average of aligned sites = 573 Number in coding regions = 468 Number in noncoding regions = 105 Number of orfs with sites within 600 bp upstream = 117 Fraction of orfs with sites within 600 bp upstream = 0.0187922 Motif number 2 TACATGTTGTAGCAACCCCGTACTGATTATG 1 4 1 ATTTAACCCT 0.997314 -288 AATATTGAATATTTTGATTAATCCCCGTACTGATTATT 1 45 0 ATTTTACCCT 0.996155 -247 AAAATATTCAATATTTATATATTCCAATATTTATTCAT 1 68 1 ATTTTACCAT 0.991377 -224 TTAAAAAATGATATTTCACTTTGCCCATGCCGTTAAAG 1 215 1 ATTTATCCCT 0.991255 -77 ATATTAGATTACGCCATTTTGAATTTAC 1 274 0 ATTTAACCAT 0.994015 -18 ** ** * * *** * Masking position 5 Map Score: 4.46018 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 15 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 ATATTTATATATTCCAATATTTATTCATTTCA 1 78 1 ATTCAATTTT 0.974947 -214 AAACACAGGTATTCCACTGGTTAATATATTCA 1 114 0 ATTCACTGTT 0.985846 -178 TACACAAGAAATAACACTCTTTTTATCGTTAA 1 187 1 ATACACTTTT 0.990709 -105 GCAAAGTGAAATATCATTTTTTAACGATAAAA 1 207 0 ATACATTTTT 0.964254 -85 ATATTAGATTACGCCATTTTGAATTTACG 1 273 0 ATTCGCCTTT 0.969085 -19 *** **** *** Masking position 2 Map Score: 1.55533 Number of sites scoring better than the average of aligned sites = 150 Number in coding regions = 123 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 4 TTCATAATCAGTACGGGGTTGCTACAACAT 1 14 0 GTACGGGGTT 0.998103 -278 AGAATAATCAGTACGGGGATTAATCAAAAT 1 43 1 GTACGGGGAT 0.997621 -249 ********** Masking position 3 Map Score: 1.35978 Number of sites scoring better than the average of aligned sites = 10 Number in coding regions = 6 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0