AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i097_Phosphate_Transport_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 pitB 291 low-affinity phosphate transport #2 gsp 156 glutathionylspermidine synthetase/amidase Motif number 1 GCAACCCCGTACTGATTATGAAGAATAATC 1 22 1 ACTGATTATG 0.986293 -270 TAATCCCCGTACTGATTATTCTTCATAATC 1 35 0 ACTGATTATT 0.976701 -257 TATTGAATATTTTGATTAATCCCCGTACTG 1 51 0 TTTGATTAAT 0.850274 -241 CAGGTATTCCACTGGTTAATATATTCACAT 1 111 0 ACTGGTTAAT 0.924099 -181 ATACCTGTGTTTTGATTATTTCTAAAGGTT 1 134 1 TTTGATTATT 0.928646 -158 GTTTTGAATGAATGCTTATTGTCTGATACA 1 161 1 AATGCTTATT 0.933311 -131 CGTTAAAGTCACTGATAATGCGTCCGTTCG 1 245 1 ACTGATAATG 0.921861 -47 CGATGAGGTGTATGATTAGTCTGACCTCTG 2 57 1 TATGATTAGT 0.894956 -100 AATTACGCCAACTGCTTAGGTTGTATTGTT 2 125 1 ACTGCTTAGG 0.966313 -32 ********** Masking position 6 Map Score: 9.51929 Number of sites scoring better than the average of aligned sites = 421 Number in coding regions = 339 Number in noncoding regions = 82 Number of orfs with sites within 600 bp upstream = 97 Fraction of orfs with sites within 600 bp upstream = 0.0155798 Motif number 2 TGATTATGAAGAATAATCAGTACGGGGATTAA 1 34 1 GAAAATCATA 0.767893 -258 GGATTAATCAAAATATTCAATATTTATATATT 1 59 1 AAAATTCATA 0.955392 -233 TTCAATATTTATATATTCCAATATTTATTCAT 1 74 1 ATAATTCCAT 0.905037 -218 ATATTCCAATATTTATTCATTTCATATGTGAA 1 86 1 ATTATTCATT 0.871062 -206 CCACTGGTTAATATATTCACATATGAAATGAA 1 101 0 ATAATTCAAT 0.976082 -191 AAACCTTTAGAAATAATCAAAACACAGGTATT 1 133 0 AAAAATCAAA 0.928013 -159 GACAATAAGCATTCATTCAAAACCTTTAGAAA 1 152 0 ATTATTCAAA 0.940815 -140 GCGTCCGTTCGTAAATTCAAAATGGCGTAATC 1 264 1 GTAATTCAAA 0.96092 -28 CAAAGGGTTAAAAAATTCACATTCTGTACAGC 2 13 0 AAAATTCAAT 0.97071 -144 *** ***** ** Masking position 7 Map Score: 7.71305 Number of sites scoring better than the average of aligned sites = 269 Number in coding regions = 173 Number in noncoding regions = 96 Number of orfs with sites within 600 bp upstream = 107 Fraction of orfs with sites within 600 bp upstream = 0.017186 Motif number 3 GTTGTAGCAACCCCGTACTGATTATGAAGA 1 16 1 CCCCGTACTG 0.99677 -276 TTTGATTAATCCCCGTACTGATTATTCTTC 1 41 0 CCCCGTACTG 0.99677 -251 AAAATTCACATTCTGTACAGCAA 2 4 0 TTCTGTACAG 0.948597 -153 TTAGTCTGACCTCTGTCCGGTTAATGTCGC 2 72 1 CTCTGTCCGG 0.98446 -85 ********** Masking position 6 Map Score: 2.45726 Number of sites scoring better than the average of aligned sites = 66 Number in coding regions = 54 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 TACATGTTGTAGCAACCCCGTACTG 1 6 1 GTTGTAGCAA 0.945039 -286 GTAAATTCAAAATGGCGTAATCTAATAT 1 274 1 AATGGCGTAA 0.961606 -18 CATCGCAGCGGCTGGCGCAAAGGGTTAAAA 2 32 0 GCTGGCGCAA 0.995635 -125 AACCTAAGCAGTTGGCGTAATTGTTGTGCT 2 117 0 GTTGGCGTAA 0.994319 -40 ********** Masking position 3 Map Score: 1.72576 Number of sites scoring better than the average of aligned sites = 634 Number in coding regions = 604 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 5 AATATATTCACATATGAAATGAATAAATAT 1 94 0 CATATGAAAT 0.879789 -198 CATTCAAAACCTTTAGAAATAATCAAAACA 1 141 0 CTTTAGAAAT 0.96717 -151 TTGTCTGATACACAAGAAATAACACTCTTT 1 179 1 CACAAGAAAT 0.915596 -113 TCTTTTTATCGTTAAAAAATGATATTTCAC 1 204 1 GTTAAAAAAT 0.948399 -88 GGCGCAAAGGGTTAAAAAATTCACATTCTG 2 19 0 GTTAAAAAAT 0.948399 -138 CACTTTACCTTTAACAATACAACCTAAG 2 139 0 CTTTAACAAT 0.873284 -18 ********** Masking position 8 Map Score: 1.20058 Number of sites scoring better than the average of aligned sites = 270 Number in coding regions = 161 Number in noncoding regions = 109 Number of orfs with sites within 600 bp upstream = 119 Fraction of orfs with sites within 600 bp upstream = 0.0191134 Motif number 6 AATGATATTTCACTTTGCCCATGCCGTTAA 1 221 1 CACTTTGCCC 0.995302 -71 AATTTTTTAACCCTTTGCGCCAGCCGCTGC 2 28 1 CCCTTTGCGC 0.992016 -129 ACAACCTAAGCAGTTGGCGTAATTGTTGTG 2 119 0 CAGTTGGCGT 0.967708 -38 CACTTTACCTTTAACAATAC 2 147 0 CACTTTACCT 0.971809 -10 ********** Masking position 5 Map Score: 0.756116 Number of sites scoring better than the average of aligned sites = 321 Number in coding regions = 292 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 7 ********** No masking Map Score: -5.44686e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -5.44686e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -5.44686e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0