AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i099_Phosphate_Transport_1_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 BIME185 97 BIME #2 pstC 86 high-affinity phosphate-specific transport system, cytoplasmic membrane component #3 pstS 300 high-affinity phosphate-specific transport system; periplasmic phosphate-binding protein Motif number 1 AGGCGCTCGGTCGGTCCCCTCGCCCCTCTG 1 51 0 TCGGTCCCCT 0.966657 -47 AAGATGACGGTTTGTCACATGGAGTTGGCA 3 60 0 TTTGTCACAT 0.978253 -241 CTACTTTTTCTCTGTCACAGAATGAAAATT 3 93 1 TCTGTCACAG 0.983744 -208 TGAAAATTTTTCTGTCATCTCTTCGTTATT 3 115 1 TCTGTCATCT 0.991839 -186 ACTTTATCTCTCTGTCATAAAACTGTCATA 3 194 1 TCTGTCATAA 0.962606 -107 CTGTCATAAAACTGTCATATTCCTTACATA 3 205 1 ACTGTCATAT 0.978445 -96 CTTACATATAACTGTCACCTGTTTGTCCTA 3 227 1 ACTGTCACCT 0.986028 -74 CTGTCACCTGTTTGTCCTATTTTGCTTCTC 3 238 1 TTTGTCCTAT 0.94138 -63 ********** Masking position 5 Map Score: 13.1688 Number of sites scoring better than the average of aligned sites = 201 Number in coding regions = 166 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 2 ACACGGTTTTCCCCTCACCCTAACCCTCTC 1 19 1 CCCCTCACCC 0.99869 -79 CCTCACCCTAACCCTCTCCCCAGAGGGGCG 1 31 1 ACCCTCTCCC 0.988 -67 CTCGGTCGGTCCCCTCGCCCCTCTGGGGAG 1 46 0 CCCCTCGCCC 0.997769 -52 CGGCGTAAAACACCGTACCCGGCCTGGAGT 2 15 0 CACCGTACCC 0.972638 -72 CGGTGTTTTACGCCGCATCCGGCATTACAA 2 30 1 CGCCGCATCC 0.991375 -57 AAGAAAAATGCCCCGCTTACGCA 3 4 0 CCCCGCTTAC 0.977651 -297 ********** Masking position 4 Map Score: 9.76822 Number of sites scoring better than the average of aligned sites = 419 Number in coding regions = 334 Number in noncoding regions = 85 Number of orfs with sites within 600 bp upstream = 56 Fraction of orfs with sites within 600 bp upstream = 0.00899454 Motif number 3 TAACCGTGTACAGAGTCAAAAAGGCGCTCGG 1 71 0 CAGATCAAAA 0.978464 -27 AAAAACATAACAGGAAGAAAAATGCCCCGCT 3 17 0 CAGGAGAAAA 0.983191 -284 CATTCTGTGACAGAGAAAAAGTAGCCGAAGA 3 86 0 CAGAAAAAAG 0.918091 -215 TTCTCTGTCACAGAATGAAAATTTTTCTGTC 3 100 1 CAGATGAAAA 0.993788 -201 TTATTTAAATCAGACTGAAGACTTTATCTCT 3 174 1 CAGATGAAGA 0.983191 -127 AGTTTTATGACAGAGAGATAAAGTCTTCAGT 3 187 0 CAGAAGATAA 0.975288 -114 **** ****** Masking position 8 Map Score: 5.649 Number of sites scoring better than the average of aligned sites = 315 Number in coding regions = 258 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 65 Fraction of orfs with sites within 600 bp upstream = 0.0104401 Motif number 4 AAGTGTTAACCGTGTACAGAGT 1 86 0 GTGTTAACCG 0.92436 -12 GCCGGGTACGGTGTTTTACGCCGCATCCGG 2 22 1 GTGTTTTACG 0.966973 -65 AGTTACTCTTCAGTTAAACGCGTTTACAAA 2 66 0 CAGTTAAACG 0.945893 -21 AGGAATATGACAGTTTTATGACAGAGAGAT 3 199 0 CAGTTTTATG 0.962975 -102 AAACAGGTGACAGTTATATGTAAGGAATAT 3 221 0 CAGTTATATG 0.950735 -80 ********** Masking position 5 Map Score: 1.85778 Number of sites scoring better than the average of aligned sites = 251 Number in coding regions = 233 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 5 CCCCTCGCCCCTCTGGGGAGAGGGTTAGGGT 1 35 0 CTCTGGGAGA 0.987536 -63 GTCAAAAAGGCGCTCGGTCGGTCCCCTCGCC 1 57 0 CGCTGGTCGG 0.990537 -41 TAAAACTCCAGGCCGGGTACGGTGTT 2 6 1 CTCCGGCCGG 0.99756 -81 AATGTCTCCTGGGAGGATTCATAAAG 3 285 0 CTCCGGGAGG 0.997925 -16 **** ****** Masking position 6 Map Score: 1.71379 Number of sites scoring better than the average of aligned sites = 138 Number in coding regions = 120 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 6 ********** No masking Map Score: -6.1574e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -6.1574e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -6.1574e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0