AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i102_Ferric_Transport_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 fecB 38 citrate-dependent iron transport, periplasmic protein #2 fecA 86 outer membrane receptor; citrate-dependent iron transport, outer membrane receptor #3 fecI 291 probable RNA polymerase sigma factor Motif number 1 AACAAAAATGATGATGGGGAAGGT 2 73 1 ATGATGGGGA 0.998506 -14 GATTTAGTGTATGATGGTGATTTTAAGGTG 3 16 0 ATGATGGTGA 0.99409 -276 ACTGCCCTAAAGGATGGGGATTTCGGTAAT 3 60 0 AGGATGGGGA 0.997456 -232 AGAATGACTCATGATGTGGTCTGCTATTAT 3 100 0 ATGATGTGGT 0.985199 -192 ********** Masking position 5 Map Score: 7.13905 Number of sites scoring better than the average of aligned sites = 21 Number in coding regions = 17 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 CTTATTTCGATTGTCCTTTTTACCCTTCTCGTTC 2 22 1 TTGCCTTACC 0.989747 -65 AATCAGTAAGTTGGCAGCATTACCGAAATCCCCA 3 42 1 TTGCAGTACC 0.989747 -250 TCTGCTATTATTGACATCCTCACTGCCCTAAAGG 3 77 0 TTGCATTACT 0.979811 -215 ACCACATCATGAGTCATTCTGACCGACACATGCC 3 110 1 GAGCATTACC 0.98669 -182 TTGTTTCCAATAGACATTTTTAACATGTTGTTTT 3 192 0 TAGCATTAAC 0.97387 -100 TTATTTCCAATTGTAATGATAACCATTCTCATAT 3 228 1 TTGAATTACC 0.976014 -64 AATTATCACGTAGTCATATTAATATGAGAATGGT 3 249 0 TAGCATTATA 0.852172 -43 *** *** * *** Masking position 12 Map Score: 4.87722 Number of sites scoring better than the average of aligned sites = 500 Number in coding regions = 456 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 58 Fraction of orfs with sites within 600 bp upstream = 0.00931577 Motif number 3 TACCTTATAACACTTAGAAAAACAACATGT 3 174 1 CACTTAGAAA 0.975818 -118 TTAAAAATGTCTATTGGAAACAATTTTATT 3 203 1 CTATTGGAAA 0.986713 -89 GTTATCATTACAATTGGAAATAAAATTGTT 3 221 0 CAATTGGAAA 0.992422 -71 ********** Masking position 8 Map Score: 1.1008 Number of sites scoring better than the average of aligned sites = 4 Number in coding regions = 1 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 AGCCCGGCAAGCCGGGCGTTAACACA 1 7 0 GCCGGGCGTT 0.99797 -32 CGCCCGGCTTGCCGGGCTTTTAGCTGGAAT 1 19 1 GCCGGGCTTT 0.998241 -20 ********** Masking position 9 Map Score: 1.09855 Number of sites scoring better than the average of aligned sites = 27 Number in coding regions = 23 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 GGAAAATAATTCTTATTTCGATTGTCC 2 8 1 AATTCTTATT 0.857801 -79 TCCTTTTTACCCTTCTCGTTCGACTCATAG 2 35 1 CCTTCTCGTT 0.956949 -52 TCCCCATCATCATTTTTGTTGTGTTCAGCT 2 63 0 CATTTTTGTT 0.953634 -24 AGGCTCCATCCCATTTTATACCTACCTTAT 3 152 1 CCATTTTATA 0.855246 -140 CTATTGGAAACAATTTTATTTCCAATTGTA 3 213 1 CAATTTTATT 0.930054 -79 TAATGATAACCATTCTCATATTAATATGAC 3 241 1 CATTCTCATA 0.945455 -51 ********** Masking position 6 Map Score: 0.682866 Number of sites scoring better than the average of aligned sites = 506 Number in coding regions = 377 Number in noncoding regions = 129 Number of orfs with sites within 600 bp upstream = 152 Fraction of orfs with sites within 600 bp upstream = 0.0244137 Motif number 6 CTTATTTCGATTGTCCTTTTTACCCTTCTC 2 22 1 TTGTCCTTTT 0.94623 -65 TCTGCTATTATTGACATCCTCACTGCCCTA 3 81 0 TTGACATCCT 0.926165 -211 ACCACATCATGAGTCATTCTGACCGACACA 3 110 1 GAGTCATTCT 0.935853 -182 TTGTTTCCAATAGACATTTTTAACATGTTG 3 196 0 TAGACATTTT 0.962676 -96 ATGATAACCATTCTCATATTAATATGACTA 3 243 1 TTCTCATATT 0.885074 -49 AATTATCACGTAGTCATATTAATATGAGAA 3 253 0 TAGTCATATT 0.971088 -39 ********** Masking position 7 Map Score: 1.29023 Number of sites scoring better than the average of aligned sites = 260 Number in coding regions = 202 Number in noncoding regions = 58 Number of orfs with sites within 600 bp upstream = 76 Fraction of orfs with sites within 600 bp upstream = 0.0122069 Motif number 7 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0