AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i105_Manganese_Transport_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 fecB 38 citrate-dependent iron transport, periplasmic protein #2 fecA 86 outer membrane receptor; citrate-dependent iron transport, outer membrane receptor #3 fecI 291 probable RNA polymerase sigma factor Motif number 1 AACAAAAATGATGATGGGGAAGGT 2 73 1 ATGATGGGGA 0.99829 -14 GATTTAGTGTATGATGGTGATTTTAAGGTG 3 16 0 ATGATGGTGA 0.99324 -276 ACTGCCCTAAAGGATGGGGATTTCGGTAAT 3 60 0 AGGATGGGGA 0.997088 -232 AGAATGACTCATGATGTGGTCTGCTATTAT 3 100 0 ATGATGTGGT 0.983092 -192 ********** Masking position 5 Map Score: 7.13905 Number of sites scoring better than the average of aligned sites = 21 Number in coding regions = 17 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 CTTATTTCGATTGTCCTTTTTACCCTTCTCGTTC 2 22 1 TTGCCTTACC 0.990738 -65 AATCAGTAAGTTGGCAGCATTACCGAAATCCCCA 3 42 1 TTGCAGTACC 0.990738 -250 TCTGCTATTATTGACATCCTCACTGCCCTAAAGG 3 77 0 TTGCATTACT 0.981746 -215 ACCACATCATGAGTCATTCTGACCGACACATGCC 3 110 1 GAGCATTACC 0.987974 -182 TTGTTTCCAATAGACATTTTTAACATGTTGTTTT 3 192 0 TAGCATTAAC 0.976361 -100 TTATTTCCAATTGTAATGATAACCATTCTCATAT 3 228 1 TTGAATTACC 0.978305 -64 AATTATCACGTAGTCATATTAATATGAGAATGGT 3 249 0 TAGCATTATA 0.864644 -43 *** *** * *** Masking position 12 Map Score: 4.87722 Number of sites scoring better than the average of aligned sites = 500 Number in coding regions = 456 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 58 Fraction of orfs with sites within 600 bp upstream = 0.00931577 Motif number 3 ACATGTTGTTTTTCTAAGTGTTATAAGGTA 3 174 0 TTTCTAAGTG 0.976898 -118 AATAAAATTGTTTCCAATAGACATTTTTAA 3 203 0 TTTCCAATAG 0.987312 -89 AACAATTTTATTTCCAATTGTAATGATAAC 3 221 1 TTTCCAATTG 0.992766 -71 ********** Masking position 6 Map Score: 1.1008 Number of sites scoring better than the average of aligned sites = 4 Number in coding regions = 1 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 TGTGTTAACGCCCGGCTTGCCGGGCT 1 7 1 AACGCCCGGC 0.997966 -32 ATTCCAGCTAAAAGCCCGGCAAGCCGGGCG 1 19 0 AAAGCCCGGC 0.998215 -20 ********** Masking position 2 Map Score: 1.09855 Number of sites scoring better than the average of aligned sites = 27 Number in coding regions = 23 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 ATCGAAATAAGAATTATTTTCC 2 3 0 GAATTATTTT 0.846768 -84 ACCTTCCCCATCATCATTTTTGTTGTGTTC 2 67 0 TCATCATTTT 0.916436 -20 ACCACATCATGAGTCATTCTGACCGACACA 3 110 1 GAGTCATTCT 0.972204 -182 TTGTTTCCAATAGACATTTTTAACATGTTG 3 196 0 TAGACATTTT 0.958438 -96 ATGTCTATTGGAAACAATTTTATTTCCAAT 3 209 1 GAAACAATTT 0.826774 -83 ATTGTAATGATAACCATTCTCATATTAATA 3 237 1 TAACCATTCT 0.915287 -55 AATTATCACGTAGTCATATTAATATGAGAA 3 253 0 TAGTCATATT 0.899355 -39 ********** Masking position 6 Map Score: 1.95537 Number of sites scoring better than the average of aligned sites = 428 Number in coding regions = 336 Number in noncoding regions = 92 Number of orfs with sites within 600 bp upstream = 115 Fraction of orfs with sites within 600 bp upstream = 0.0184709 Motif number 6 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0