AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i107_TRK_operon_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 trkG 137 trk system potassium uptake; part of Rac prophage #2 def 129 peptide deformylase #3 sun 45 orf, hypothetical protein #4 trkA 21 transport of potassium Motif number 1 ATCAAAATGAATCATATTGTAGTTAAGATT 1 11 0 ATCATATTGT 0.888727 -127 CTCCTCTTAGATCTTACTTCACTGTTCCTT 1 52 0 ATCTTACTTC 0.940248 -86 CAGTATAATCATAATATTGCAGCAAGGTGG 1 94 1 ATAATATTGC 0.965951 -44 TTCAATTATAACCACCTTGCTGCAATATTA 1 105 0 ACCACCTTGC 0.964138 -33 ATCTAAATATTCTTTCAATTATAACC 1 122 0 ATATTCTTTC 0.95899 -16 CCTTATCTCCCTGCCATAAGCAGC 2 5 1 ATCTCCCTGC 0.97834 -125 AATAGAAGAAATAATCTTTCTAACTCCTGA 2 92 1 ATAATCTTTC 0.968182 -38 ********** Masking position 1 Map Score: 5.06719 Number of sites scoring better than the average of aligned sites = 1480 Number in coding regions = 1337 Number in noncoding regions = 143 Number of orfs with sites within 600 bp upstream = 155 Fraction of orfs with sites within 600 bp upstream = 0.0248956 Motif number 2 AATCTTAACTACAATATGATTCATTT 1 5 1 TTCTACAATA 0.991897 -133 AGGAGTTAAATTTTATACAGTATAATCATAAT 1 77 1 TTATACAGTA 0.913034 -61 TTATAACCACCTTGCTGCAATATTATGATTAT 1 98 0 CTCTGCAATA 0.993054 -40 CCTTATCTCCCTGCCATAAGCAGCCTTA 2 7 1 CTCTGCCATA 0.984728 -123 AGAGGGGGATTTGTCTAGAATAGAAGAAATAA 2 74 1 TTCTAGAATA 0.963962 -56 ** ******** Masking position 6 Map Score: 0.997425 Number of sites scoring better than the average of aligned sites = 155 Number in coding regions = 124 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 3 CTGTTCCTTATGAAACAATCATCAAAATGA 1 31 0 TGAAACAATC 0.985376 -107 TGGTTATAATTGAAAGAATATTTAGAT 1 121 1 TGAAAGAATA 0.959615 -17 CCCCTCTGATTGACAGCATCACTGACCAAT 2 51 0 TGACAGCATC 0.983687 -79 CTAGAATAGAAGAAATAATCTTTCTAACTC 2 88 1 AGAAATAATC 0.932515 -42 TTCTAACTCCTGAACACATCTCTGGAGATT 2 109 1 TGAACACATC 0.956726 -21 ********** Masking position 3 Map Score: 1.67461 Number of sites scoring better than the average of aligned sites = 377 Number in coding regions = 335 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 50 Fraction of orfs with sites within 600 bp upstream = 0.00803084 Motif number 4 GTTTCATAAGGAACAGTGAAGTAAGATCTA 1 45 1 GAACAGTGAA 0.971965 -93 TAAGATCTAAGAGGAGTTAAATTTTATACA 1 66 1 GAGGAGTTAA 0.991875 -72 GTCTAGAATAGAAGAAATAATCTTTCTAAC 2 86 1 GAAGAAATAA 0.868182 -44 GAGATGTGTTCAGGAGTTAGAAAGATTATT 2 101 0 CAGGAGTTAG 0.939825 -29 ACCGGGCTTAGAAGAGTGGACTA 3 4 0 GAAGAGTGGA 0.98214 -42 ********** Masking position 5 Map Score: 0.680991 Number of sites scoring better than the average of aligned sites = 376 Number in coding regions = 313 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 76 Fraction of orfs with sites within 600 bp upstream = 0.0122069 Motif number 5 ********** No masking Map Score: 4.42969e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 4.42969e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 4.42969e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0